Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 396 results for: promoter

Showing: 261 - 280 of 396 results

  5. Plasmids 101: Golden Gate Cloning

    Type
    Blog Post
    ...orientation. This allows for multiple DNA components (promoters, genes, terminators, etc) to be assembled in the...

  6. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...

  7. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Yeast...Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids that should...

  8. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable ...modifiers. Design your gRNA to target a specific promoter or enhancer for your gene of interest. Available...

  9. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...

  10. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  11. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  13. A Look at Addgene's QC Process

    Type
    Blog Post
    ...they ordered contains the correct inserts, tags, promoters, and other critical functional components. Fun...

  14. Progress Towards a PAM-Free CRISPR

    Type
    Blog Post
    ...surprise since the PAM flexibility could in theory promote off-target binding. The activity of SpRY was validated...

  17. Hot Plasmids - October 2020

    Type
    Blog Post
    ...express hybrid Cas9-Cas12a gRNAs under a single U6 promoter. The paralog and dual-targeting hybrid gRNA library...

  20. dTAG - You're it!

    Type
    Blog Post
    ... al. YY1 Is a Structural Regulator of Enhancer-Promoter Loops. Cell. December 14 2017. 171(7):1573-1588...
Showing: 261 - 280 of 396 results