... aptamer binding protein for packaging into a lentivirus-like particle. Read the paper in Nucleic Acids...

...pXPR_071, a plasmid that leads to higher titer lentivirus preparations than the first generation CHIME ...

...technology.” GeCKO library for genomic screens Using lentivirus as the delivery vehicle, Neville Sanjana, also...

...their vaccine production, SARS-CoV-2 research, or adenovirus packaging cell lines dataset collections.  Depending...

...expression. Because calcineurin is required for virulence in pathogenic fungi, it is an attractive drug ...

...reprogramming and differentiation Check out our lentivirus guide Sign up to receive our Viral Vectors 101...

...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse primer...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg...-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...Forward GCTCGATACAATAAACGCC (Invitrogen) Rous sarcoma virus (RSV) promoter, forward primer pRS-marker CGGCATCAGAGCAGATTGTA...primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of Rous sarcoma virus (RSV) env gene, forward primer Rluc-F CCAGGATTCTTTTCCAATGC...

...the COVID-19 pandemic, check out Care For Your Coronavirus Anxiety and Taking Care of Your Behavioral Health...

...Resources on the Addgene Blog Learn More about Lentivirus Figure out How to Get the Most from Your Lentiviral...

...endonuclease mediated gene disruption in the HIV provirus. Sci. Rep. 6, 20064 (2016). PubMed PMID: 26829887...

...you are equipped and authorized to make and use lentivirus. Also, note that due to the size of the backbone...

...infection. When using the ClonTracer system, lentiviruses containing these barcodes infect the target ...

...been constructed. Additionally, Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to...

...lentiviral particles (for details about lentivirus, see our Lentivirus Guide ) Stable, tunable expression ...

... BirA, and 3) one or more gRNAs Two separate lentiviruses delivering 1) a BioTAP-tagged dCas9 and an eGFP...

... for Your Experiments Get Ready-to-Use CRISPR Lentivirus ...

... to target multiple delivery systems, such as lentivirus and MMLV gag, to specific cell types. It can ...

...focusing on my technical skills with cloning and lentivirus production, I didn’t really start to recognize...

...HDR. PASTE is also compatible with both AAV and adenovirus templates. The system, which is larger than Cas9...

...Seroogy, C. (2017). Neonatal immune response to rhinovirus A16 has diminished dendritic cell function and...