...information will populate a list of possible Entrez Gene matches to your insert. Select the appropriate gene if ...

...with Cpf1 Additional Resources on Addgene.org Catch Up on Your CRISPR Background with Our Guide Pages...

...reporters Additional Resources on Addgene.org Catch up on your CRISPR background with our CRISPR Guide...

...Fluorescent Proteins 101 Science Career Guide Videos Watch our collection of video content , including protocols...

...shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate ...

...small aliquots of many different antibodies and do batch validation up front rather than risk delaying a ...

...BSL-1 and BSL-2 Watch the Video! Water Baths Proper water bath maintenance and use Watch the Video! Pipetting...plate Watch the Video! Streaking Bacteria Isolate single bacterial colonies on an agar plate Watch the ...enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with tips and FAQ Watch the Video... a gel Watch the Video! How to Design a Primer Key considerations when designing primers Watch the Video...recombinant antibodies Watch the Video! Western Blot Separate and detect specific proteins Watch the Video! Immunocytochemistry...protect yourself when working in BSL-1 and BSL-2 labs Watch the Video! Lab Safety for Biosafety Levels One and...dispense liquids, and how to handle the pipette Watch the Video! Centrifugation Learn about selecting ...

...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...

...determined for each new batch of 1 mg/mL PEI prepared. There may be variation between batches of PEI depending... volumes, pH adjustment etc. Consequently, each batch needs to be validated and the best ratio of mass... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...

...OptiPro SFM per 10 cm dish. Pro-Tip There can be batch to batch variation when making the PEI working stock... need to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...

...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number...untransduced control. Pro-Tip For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of ...

...genes, as one does not need to prepare separate batches of antibiotic-containing agar. This protocol will...concentration. Last Update: Oct. 27, 2017 Protocol Video Watch the protocol video below to learn how to spread ...

...search for 21nt sequences that match the pattern AA(N 19 ). If no suitable match is found, search for NAR(N...Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. TIP: Addgene recommends...

...each reaction Tips and FAQs My sequence doesn’t match Addgene’s sequencing result, what should I do? Check... Check your trace file first; the apparent mismatch/mutation may be the result of a mis-called peak in...

...overnight culture of liquid LB with bacteria. Video Watch the protocol video below to learn how to inoculate...Double check that the antibiotic in your LB media matches the antibiotic resistance on your plasmid. If the...

...transformations. Last Update: Nov. 13, 2017 Protocol Video Watch the protocol video below to learn how to isolate...antibiotic. The resistance gene on your plasmid must match the antibiotic on the plate. You should also add...

... dose for the colony formation assay. Prepare a batch of DMEM complete containing 10 μg/mL polybrene by...cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into 9.45...

... the pipette. Last Update: September 2022 Video Watch the video for tips on pipetting in the lab. Equipment...may consider using a multichannel pipette. Please watch Addgene’s protocol on multichannel pipetting to ...

...lengths). Last Update: Feb. 20, 2018 Protocol Video Watch the protocol video below to learn how to perform...Very slowly and steadily, push the sample out and watch as the sample fills the well. After all of the sample...

...lowest dose that kills all of the cells. Prepare a batch of DMEM complete + 10 µg/mL polybrene by diluting...solution in this step. To seed the cells: Prepare a batch of cells as follows: Dilute 350,000 cells into a...