We narrowed to 343 results for: ATC

...reporters Additional Resources on Addgene.org Catch up on your CRISPR background with our CRISPR Guide...

...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin...Forward LacI-R GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ ...LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter...Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC Moloney...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...Forward GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of...

...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4...

...the selected target sequence. Additionally, any mismatches between a given gRNA sequence and your genomic...Method CRISPR Edit Type Additional Considerations Mismatch cleavage assay Knockouts Some point mutations ...

...Fluorescent Proteins 101 Science Career Guide Videos Watch our collection of video content , including protocols...

..., T., Sugg, E. E., Candelore, M. R., Keys, R., Patchett, A. A., & Dixon, R. A. (1991). Allele-specific...

...plasmid and the adenoviral backbone plasmid have matching left and right homology arms which facilitate ...

...rAAV capsids. Learn more about optogenetics by watching our Optogenetics 101 video or by visiting Addgene's...

...small aliquots of many different antibodies and do batch validation up front rather than risk delaying a ...

...BSL-1 and BSL-2 Watch the Video! Water Baths Proper water bath maintenance and use Watch the Video! Pipetting...plate Watch the Video! Streaking Bacteria Isolate single bacterial colonies on an agar plate Watch the ...enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with tips and FAQ Watch the Video... a gel Watch the Video! How to Design a Primer Key considerations when designing primers Watch the Video...recombinant antibodies Watch the Video! Western Blot Separate and detect specific proteins Watch the Video! Immunocytochemistry...protect yourself when working in BSL-1 and BSL-2 labs Watch the Video! Lab Safety for Biosafety Levels One and...dispense liquids, and how to handle the pipette Watch the Video! Centrifugation Learn about selecting ...

...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...

...determined for each new batch of 1 mg/mL PEI prepared. There may be variation between batches of PEI depending... volumes, pH adjustment etc. Consequently, each batch needs to be validated and the best ratio of mass... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...

...OptiPro SFM per 10 cm dish. Pro-Tip There can be batch to batch variation when making the PEI working stock... need to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...

...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number...untransduced control. Pro-Tip For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of ...

...genes, as one does not need to prepare separate batches of antibiotic-containing agar. This protocol will...concentration. Last Update: Oct. 27, 2017 Protocol Video Watch the protocol video below to learn how to spread ...

...search for 21nt sequences that match the pattern AA(N 19 ). If no suitable match is found, search for NAR(N...Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. TIP: Addgene recommends...

...each reaction Tips and FAQs My sequence doesn’t match Addgene’s sequencing result, what should I do? Check... Check your trace file first; the apparent mismatch/mutation may be the result of a mis-called peak in...

...culture of liquid LB with bacteria. Video Protocol Watch the protocol video below to learn how to inoculate...Double check that the antibiotic in your LB media matches the antibiotic resistance on your plasmid. If the...

...transformations. Last Update: Nov. 13, 2017 Protocol Video Watch the protocol video below to learn how to isolate...antibiotic. The resistance gene on your plasmid must match the antibiotic on the plate. You should also add...

... dose for the colony formation assay. Prepare a batch of DMEM complete containing 10 μg/mL polybrene by...cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into 9.45...