We narrowed to 334 results for: uros
-
TypeBlog Post...semi-quantitative immunoblotting. Journal of Neuroscience Methods, 172(2), 250–254. https://doi.org/10.1016...
-
Depositor Collections
TypeCollection...Special Collections Pooled Libraries Antibodies NeuroMab/Trimmer Lab Recombinant mAb Plasmid Collection...Michael J. Fox Foundation Plasmid Resource iPSC Neurodegenerative Disease Initiative (iNDI) Collection Rett ... -
AAV Viral Preps
TypeCollection...Purification, Cell Ablation, CRISPR Monosynaptic Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1,... -
All Antibodies
TypeCollection...Myc, GFP, and more. Neuroscience : Antibodies targeting proteins for neuroscience research. Institute ... -
Plasmid Collections
TypeCollection...MJFF) Plasmid Collection Neuroendocrine Tumor Research Foundation Neurodegeneration Research Collection Rett... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...repression system can be found in this article: Vigouroux, A., Oldewurtel, E., Cui, L., Bikard, D., & Van...different populations. Image and caption from Vigouroux et al., 2018, under a CC BY 4.0 license.... -
Synthetic Biology - Overview
TypeCollection... O'Shea Martin Parniske Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela Silver Lei Stanley... Open access papers on Syn Bio SEVA - Standard European Vector Architecture Open Plant - Plant SynBio ... -
Microbiology Resources
TypeCollection...External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (Link opens... -
Ras Pathway
TypeCollection...homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 ...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1... -
CRISPR References and Information
TypeCollection...construct ; pMA122 (negative selection marker); pGH8 (neuronal co-injection marker); pCFJ104 (body wall muscle... 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control... -
Optogenetics AAV Preps
TypeCollection...Optogenetics is typically used in neuroscience to control electrical potentials in neurons. See our Optogenetics ... -
Retrograde AAV viral preps
TypeCollection...transgene delivery to projection neurons. Specific classes of projection neurons can be targeted by using this... -
CRISPR Pooled gRNA Libraries
TypeCollection...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation... -
Chemogenetics Guide
TypeGuide...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor... and outcome in neurons. Table 2. Descriptions of PSAMs and their activity in neurons PSAM Ion Pore Domain...Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2011 PSAM L141F,Y115F Gly PSEM 89S Cl - influx Neuronal inhibition...and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference LMO3 sbGLuc...expressed. However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs... -
Validated gRNA Sequences
TypeCollection... Zhang Neurog2 H. sapiens GTCTCTATCACTGATAGGGA 64161 activate S. pyogenes 25619936 Sato Neurog2 H. sapiens... -
Optogenetics Guide
TypeGuide...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed to light of the correct...cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics tools can be broadly...and nervous system to better map and understand neuronal circuits. Optogenetic tools have also been used...Drosophila. These tools have been instrumental in neurological disorder research, helping scientists to better... -
Adeno-associated virus (AAV) Guide
TypeGuide...access to projection neurons . Neuron, 92 (2), 372–382. https://doi.org/10.1016/j.neuron.2016.09.021 (Link...and cancer. Neuronal Tracing Recombinant AAV vectors have been widely used by neuroscientists to study neural... between neurons within the brain. Large-scale examples of mapping the brain through neuronal tracing ...post on using AAV for neuronal tracing . Browse AAV vectors for monosynaptic neuronal tracing available at...and alter tropism. For example, AAV2/5, targets neurons that are not efficiently transduced by AAV2, and...engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde transport...transport refers to the direction of movement within a neuron from the terminal part of the axon towards the ... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...research. This collection is part of Addgene's Neurodegeneration Research Collection , which includes other... -
Brzezinski Lab CRISPR Collection
TypeCollection...requires a unique enhancer and either Ascl1 or Neurog2 activity . Development, 148(12). doi: 10.1242/dev... -
Adenovirus Plasmids
TypeCollection...production of viruses containing transgene under Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP...