We narrowed to 8 results for: uros

.... DREADDs for Neuroscientists. Neuron, 89 (4), 683–694. https://doi.org/10.1016/j.neuron.2016.01.040 PMID...control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD Receptor... and outcome in neurons. Table 2: Descriptions of PSAMs and their activity in neurons PSAM Ion Pore Domain...Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2011 PSAM L141F,Y115F Gly PSEM 89S Cl - influx Neuronal inhibition...and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference LMO3 sbGLuc...

...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the...brain circuits. J Neurosci, 26 (41), 10380–10386. https://doi.org/10.1523/JNEUROSCI.3863-06.2006 PMID:...genetic engineering to manipulate cells (frequently neurons) and their governing biomolecular processes with...channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed to light of the correct...cations flow into the cell (yellow dots), and the neuron is activated. In the past, the field of optogenetics...and nervous system to better map and understand neuronal circuits. Optogenetic tools have also been used...

...access to projection neurons . Neuron, 92 (2), 372–382. https://doi.org/10.1016/j.neuron.2016.09.021 (Link...and cancer. Neuronal Tracing Recombinant AAV vectors have been widely used by neuroscientists to study neural... between neurons within the brain. Large-scale examples of mapping the brain through neuronal tracing ...post on using AAV for neuronal tracing . Browse AAV vectors for monosynaptic neuronal tracing available at...and alter tropism. For example, AAV2/5, targets neurons that are not efficiently transduced by AAV2, and...engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde transport...transport refers to the direction of movement within a neuron from the terminal part of the axon towards the ...

...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus...

...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

...935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T...