Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 8 results for: uros

Showing: 1 - 8 of 8 results

  1. Chemogenetics Guide

    Type
    Guide
    ...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor... and outcome in neurons. Table 2. Descriptions of PSAMs and their activity in neurons PSAM Ion Pore Domain...Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2011 PSAM L141F,Y115F Gly PSEM 89S Cl - influx Neuronal inhibition...and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference LMO3 sbGLuc...expressed. However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs...

  2. Optogenetics Guide

    Type
    Guide
    ...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed to light of the correct...cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics tools can be broadly...and nervous system to better map and understand neuronal circuits. Optogenetic tools have also been used...Drosophila. These tools have been instrumental in neurological disorder research, helping scientists to better...

  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...access to projection neurons . Neuron, 92 (2), 372–382. https://doi.org/10.1016/j.neuron.2016.09.021 (Link...and cancer. Neuronal Tracing Recombinant AAV vectors have been widely used by neuroscientists to study neural... between neurons within the brain. Large-scale examples of mapping the brain through neuronal tracing ...post on using AAV for neuronal tracing . Browse AAV vectors for monosynaptic neuronal tracing available at...and alter tropism. For example, AAV2/5, targets neurons that are not efficiently transduced by AAV2, and...engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde transport...transport refers to the direction of movement within a neuron from the terminal part of the axon towards the ...

  4. Sequencing Primers

    Type
    Guide
    ... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer...

  5. Science Guides

    Type
    Guide
    ...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...

  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

  7. Lentiviral Vector Guide

    Type
    Guide
    ... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

  8. CRISPR Guide

    Type
    Guide
    ...935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T...
Showing: 1 - 8 of 8 results