We narrowed to 332 results for: cloning
- 
  TypeGuide...of one clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... bind to any given antigen. A mature B cell can clone itself to enable higher production of a single antibody...where each culture should produce the same antibody clone, or from plasmid-based expression. Monoclonal antibodies...
 - 
  
Tips for Titering Your Lentiviral Preps
TypeBlog Post...sorting based on expression of a surface marker, subcloning, expansion, and confirmation. This procedure ... - 
  
Antibodies 101: Introduction to Antibodies
TypeBlog Post...antigen to myeloma cells. The hybridomas are then subcloned by limiting dilution, which produces an immortalized... - 
  
Addgene's eBook Collection
TypeGuide...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101... - 
  
Sequencing Primers
TypeGuide...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE... - 
  
CRISPR Guide
TypeGuide...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include... - 
  
Optogenetics Guide
TypeGuide...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ... - 
  
General Transfection
TypeProtocol...function. We specifically use this protocol with a subclone of HEK293T cells optimized for viral production...Workflow Timeline Day 0: Seed HEK293T cells (or a subclone of HEK293T optimized for viral production) Day... - 
  
Immunology Research Plasmids and Resources
TypeCollection...MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building blocks: 14 different...kinases and kinase-related open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation... - 
  
AAV ddPCR Titration
TypeProtocol... (x 3) Reagents Molecular Biology Grade Water, Hyclone, SH30538.02 GeneAmp 10X PCR Buffer, Applied Biosystems... - 
  
Lentivirus ddPCR Titration
TypeProtocol...Millipore, TR-1003-G Molecular Biology Grade Water, Hyclone, SH30538.02 ddPCR Supermix for Probes no dUTP, ... - 
  
Trimmer Lab NeuroMab Collection
TypeCollection...applications. A substantial number of these have been cloned, expressed and validated in recombinant form. The...