We narrowed to 329 results for: cloning
-
TypeGuide...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...
-
Sequencing Primers
TypeGuide...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC... -
CRISPR Guide
TypeGuide...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include... -
Optogenetics Guide
TypeGuide...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ... -
General Transfection
TypeProtocol...function. We specifically use this protocol with a subclone of HEK293T cells optimized for viral production...Workflow Timeline Day 0: Seed HEK293T cells (or a subclone of HEK293T optimized for viral production) Day... -
Immunology Research Plasmids and Resources
TypeCollection...MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building blocks: 14 different...kinases and kinase-related open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation... -
AAV ddPCR Titration
TypeProtocol... (x 3) Reagents Molecular Biology Grade Water, Hyclone, SH30538.02 GeneAmp 10X PCR Buffer, Applied Biosystems... -
Lentivirus ddPCR Titration
TypeProtocol...Millipore, TR-1003-G Molecular Biology Grade Water, Hyclone, SH30538.02 ddPCR Supermix for Probes no dUTP, ... -
Trimmer Lab NeuroMab Collection
TypeCollection...applications. A substantial number of these have been cloned, expressed and validated in recombinant form. The...