Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 14 results for: cloning

Showing: 1 - 14 of 14 results

  1. Cloning

    Type
    Guide
    ... a Molecular Cloning Technique Molecular Cloning Techniques You may also like... Cloning Resources Empty...101: Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid...Plasmid 101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of ...via gateway cloning. Back to Top TOPO® Cloning TOPO (Image from Plasmid 101: TOPO Cloning ) Toposiomerase...Toposiomerase based cloning, often called TOPO® cloning or TA cloning, is a method that relies on the hybridization...MoClo and Golden Gate cloning kits for your next cloning project. Golden Gate Cloning (Image from Plasmid...Golden Gate Cloning ) Back to Top Ligation Independent Cloning Ligation Independent Cloning (LIC) relies...

  2. Modular Cloning Guide

    Type
    Guide
    ...Biology Reference Molecular Cloning Techniques MoClo Guide Modular Cloning (MoClo) Guide You may also ...Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids... Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo) is a system for...enzymes, and mechanisms. zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome...pre-assembled pFusX clones allowing for Golden Gate assembly of 15-16 RVD TALEN inserts in one cloning step rather...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...more. The MoClo system consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in...

  3. Molecular Biology Reference

    Type
    Guide
    ...plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors tend ...thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this... is known as DNA or molecular cloning . The process of molecular cloning enabled scientists to break chromosomes...about different types of cloning methods check out our guide on molecular cloning techniques . Plasmid Elements...optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry... help you choose the right cloning method Plasmids 101: Restriction Cloning Plasmids 101: Inducible Promoters...as genes. Creation of recombinant DNA Molecular Cloning Plasmids that are used most commonly in the field...

  4. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...

  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...

  6. Plan Your Experiment

    Type
    Guide
    ...using standard restriction-ligation cloning. However, the exact cloning strategy will depend on the gRNA ...including selecting the edit type, designing and cloning a gRNA, delivering Cas and the gRNA, and validating...Introduction Select Genetic Manipulation Design and Clone gRNA Select Expression and Delivery Validate Genetic...the multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving your desired edit comes down...few factors to keep in mind when designing and cloning your gRNAs. Select Genetic Element to be Targeted... about how to design your gRNA . Synthesize and Clone Desired gRNAs Once your target sequences are selected...selected, it’s time to design your gRNA oligos and clone them into your desired vector. In many cases, you...

  7. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral plasmids. Lentiviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...Molecular Biology Reference . Production After cloning, you will need to produce the lentiviral vectors ...Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production Generating...

  8. Adenovirus Guide

    Type
    Guide
    ...BioRender.com. Adenoviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...production. In AdEasy™, the transgene of interest is cloned into the shuttle plasmid, verified, and linearized...

  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... with BioRender.com. AAV Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...

  10. Antibody Guide

    Type
    Guide
    ...of one clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... bind to any given antigen. A mature B cell can clone itself to enable higher production of a single antibody...where each culture should produce the same antibody clone, or from plasmid-based expression. Monoclonal antibodies...

  11. Addgene's eBook Collection

    Type
    Guide
    ...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...

  12. Sequencing Primers

    Type
    Guide
    ...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...

  13. CRISPR Guide

    Type
    Guide
    ...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include...

  14. Optogenetics Guide

    Type
    Guide
    ...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ...
Showing: 1 - 14 of 14 results