We narrowed to 14 results for: cloning
-
TypeGuide...BioRender.com. TOPO Cloning Toposiomerase-based cloning, often called TOPO cloning or TA cloning, is a method... Gateway Recombination Cloning Gateway cloning is a recombination-based cloning method. During Gateway...Golden Gate cloning kits for your next cloning project. Read more in our Golden Gate Cloning blog post ...Gate cloning. Created with BioRender.com. Ligation Independent Cloning Ligation Independent Cloning (LIC...independent cloning Addgene Blogs Plasmids 101: Restriction Cloning Plasmids 101: Gateway Cloning Plasmids...about different molecular cloning techniques, focusing on seven common cloning methods. Educational...Molecular Biology Reference Molecular Cloning Techniques Molecular Cloning Techniques Restriction Enzyme Gateway...
-
Modular Cloning Guide
TypeGuide...Biology Reference Molecular Cloning Techniques MoClo Guide Modular Cloning (MoClo) Guide You may also ...Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids... Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo) is a system for...enzymes, and mechanisms. zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome...pre-assembled pFusX clones allowing for Golden Gate assembly of 15-16 RVD TALEN inserts in one cloning step rather...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...more. The MoClo system consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in... -
Molecular Biology Reference
TypeGuide...Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of DNA fragments. Cloning vectors tend to...optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry...entry vectors and TOPO cloning vectors. Empty Backbones , Cloning Kits Expression Plasmids Used for gene...molecule is known as DNA or molecular cloning. The advent of molecular cloning enabled scientists to break chromosomes...about different types of cloning methods, check out our guide on molecular cloning techniques . Common Bacteria...Plasmids Plasmid Elements Types of Plasmids Molecular Cloning Common E. coli Strains Common Antibiotics DNA Sequencing...molecular biology resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins... -
Educational Resources
TypeGuide...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols... -
Gamma-Retroviral Vector Guide
TypeGuide...BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular... -
Plan Your Experiment
TypeGuide...using standard restriction-ligation cloning. However, the exact cloning strategy will depend on the gRNA ...including selecting the edit type, designing and cloning a gRNA, delivering Cas and the gRNA, and validating...Introduction Select Genetic Manipulation Design and Clone gRNA Select Expression and Delivery Validate Genetic...the multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving your desired edit comes down...few factors to keep in mind when designing and cloning your gRNAs. Select Genetic Element to be Targeted... about how to design your gRNA . Synthesize and Clone Desired gRNAs Once your target sequences are selected...selected, it’s time to design your gRNA oligos and clone them into your desired vector. In many cases, you... -
Lentiviral Vector Guide
TypeGuide...lentiviral plasmids. Lentiviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...Molecular Biology Reference . Production After cloning, you will need to produce the lentiviral vectors ...Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols Lentiviral Vector Production Generating... -
Adenovirus Guide
TypeGuide...BioRender.com. Adenoviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular...production. In AdEasy™, the transgene of interest is cloned into the shuttle plasmid, verified, and linearized... -
Adeno-associated virus (AAV) Guide
TypeGuide... with BioRender.com. AAV Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...ccdB-resistant strain is necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular... -
Antibody Guide
TypeGuide...of one clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... bind to any given antigen. A mature B cell can clone itself to enable higher production of a single antibody...where each culture should produce the same antibody clone, or from plasmid-based expression. Monoclonal antibodies... -
Addgene's eBook Collection
TypeGuide...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101... -
Sequencing Primers
TypeGuide...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE... -
CRISPR Guide
TypeGuide...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some... the desired edit experimentally and to isolate clones containing the desired edit (see: Validate genetic...designed in silico and synthesized (Figure 8A), then cloned in a pooled format into lentiviral transfer vectors...PAM sequence in the genomic DNA. This sequence is cloned into a gRNA expression plasmid but does NOT include... -
Optogenetics Guide
TypeGuide...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ...