We narrowed to 347 results for: SAM activators

...Saturday Hack Day projects sought to make an interactive game that highlights just this point. As part...underrepresented groups under their mentorship with the same critical eye they place on others within their labs...

...three loxP variants, but the principles remain the same. The first fluorescent protein in the construct,...proteins and confirmed that there was no cross-reactivity, opening the door for immunostaining analysis...

...differentiation.” Specific cell media, supplements, bioactive small molecules, and growth factors are used to...human induced pluripotent stem cells from urine samples. Nat Protoc, 2012. 7(12): p. 2080-9. PubMed PMID...

...rAdV vectors are highly immunogenic because they activate both innate and adaptive immune responses in the... elements into the genome, often altering gene activity. Oncolytic Referring to the destruction of cancer...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...

...Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3'... CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV... GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3...

...Takashi Yamamoto Plasmids for construction of highly-active Platinum TALENs for use in a wide variety of target... Mammalian Toolkit Mammalian Expression Hana El-Samad 253 plasmids that allow for the assembly of cellular...

...luciferase or GFP) that offers a readout of the activity of the genetic element. For instance, a promoter... in a process called transcription. RNA uses the same nucleotide bases as DNA, except thymine is replaced...natural amino acids, so multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer... cells are called clones, since they contain the same genetic information as the parental cell. The plasmid...