...experiment, make sure your workspace is clean and uncluttered. Disinfect your workspace with appropriate materials...times for each agent. Make sure you have enough space to work at your lab bench. It’s possible that while...

... differences, and plasmid recombination can all impact the representation of individual plasmids in the...problem as these sequences are not efficiently packaged into lentiviral particles. See below for options...overloaded. If you find that your pellet outstrips the capacity listed in the Maxiprep protocol, scale the reagent...

... appropriate for the biosafety level of the lab space Reagents Sample to be centrifuged Water Background...picture above. Wear PPE appropriate for the lab space in which you are working. Even if your samples may...

...effects. The library was cloned into the Liu lab’s own pAc-sgRNA-Cas9 insect expression backbone, which expresses...be found here). To use the library, the authors packaged it into lentivirus and used the resulting lentiviral...large size of dCas9-VPR limits one’s ability to package it into lentivirus and later create stable cell...cells. The piggybac system has a much larger cargo capacity than lentivirus and is capable of efficiently ...

... of AAV is currently limited by its small packaging capacity (∼4.5 kb including ITRs), though there is...as well as our Packaged on Request service to give you more flexibility. AAV Packaging Plasmids The following...AAV1 AAV packaging plasmid, expressing Rep2 and Cap1 Wilson 104963 pAAV2/2 AAV2 AAV packaging plasmid,... AAV5 AAV packaging plasmid, expressing Rep2 and Cap5 Fan 112863 pAAV2/7 AAV7 AAV packaging plasmid, expressing...AAV8 AAV packaging plasmid, expressing Rep2 and Cap8 Wilson 112865 pAAV2/9n AAV9 AAV packaging plasmid,...All Available AAV Packaging Plasmids This table contains helper plasmids for packaging your AAV product...Blog: AAV use in CRISPR Viral Vectors 101 eBook Packaging Plasmids AAV Plasmids Adeno-associated viruses...

...along with additional packaging components Trono 63586 psPAX2-D64V 2nd Packaging For making Integrase ...22500 pNHP 2nd Packaging Contains gag, pol, tat, rev Kasparov 1732 pCPRDEnv 2nd Packaging part of the FELIX...strain). Use with packaging construct encoding Tat. Reiser 17531 pCD/NL-BH*DDD 2nd Packaging Contains Gag/...Addgene lentiviral packaging, envelope, and transfer plasmids Viral...Lentiviral Pooled Libraries All Viral Plasmids Packaging Plasmids Transfer Plasmids Lentiviruses, a subset...lentiviral terms Popular Lentiviral Envelope and Packaging Plasmids One safety feature of lentivirus used...multiple plasmids. Some plasmids (typically called packaging and envelope plasmids) encode components of the...

... Plasmid 48223 pAC91-pmax-dCas9VP64 : dCas9VP64 on pmax expression vector. 48224 pAC92-pmax-dCas9VP96 ...vector. 48225 pAC93-pmax-dCas9VP160 : dCas9VP160 on pmax expression vector. 48226 pAC94-pmax-dCas9VP160...Plasmid 48214 pAC1-pCR8-dCas9VP48 : dCas9VP48 on Gateway donor vector pCR8/GW/TOPO. 48218 pAC84-pCR8-dCas9...TOPO. 48219 pAC147-pCR8-dCas9VP64 : dCas9VP64 on Gateway donor vector pCR8/GW/TOPO. 48220 pAC148-pCR8-dCas9VP96...Activators sgRNA Dual Expression ID Plasmid 48236 pAC2-dual-dCas9VP48-sgExpression : Dual expression construct...dCas9VP48 and sgRNA from separate promoters. 48238 pAC152-dual-dCas9VP64-sgExpression : Dual expression construct...dCas9VP64 and sgRNA from separate promoters. 48239 pAC153-dual-dCas9VP96-sgExpression : Dual expression construct...

...want to use double nickase, you could express two spacers and use PX335 to express the Cas9n (nickase). The...PAM sequence to the oligo when cloning my target spacers into the PX330 vector backbone? There is no need...usually adds it when they order the oligo. If your spacer sequence starts with a 'G', you naturally have ... compared to where the target site sequence (protospacer+PAM) is located? If there are other PAMs in the... there needs to be extensive homology of the protospacer followed by PAM. Click here for a target selection... together, with each plasmid having a targeting spacer cloned into the backbone ( pX330 or PX335 , depending...two genomic loci with wildtype Cas9, clone two spacers for each locus into PX330, then co-transfect or...

...Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial TAG Farren... Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial TAG Farren...141173 pAcBac1-3nitroY-A7-RS A7 3nY tRNA synthetase M. barkeri Mammalian Ryan Mehl 141174 pAcBac1-haloTyrRS...acid Bacerial, Mammalian TAG Peter Schultz 50831 pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli... amino acids Mammalian TAG Peter Schultz 50832 pAcBac1.tR4-MbPyl PylRS M. barkeri variety of unnatural...barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl 174081 pAcBac1-NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84...barkeri acridone Bacterial TAG Ryan Mehl 174101 pAcBac1.tR4-AcdRS82 Acridone 82 tRNA synthetase M. barkeri...

...referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before...for Cas-binding and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified....target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG)... an active, DNA-binding configuration, with the spacer region of the gRNA left free to interact with the...Cas9 will only cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target...throughout the genome, called off-targets, that can impact your experiment. There are many online tools available...Cas9’s interactions with DNA phosphate backbone HypaCas9 - increase Cas9 proofreading and discrimination...

...contains many unique protospacer sequences that have homology to foreign DNA. Protospacers are separated by...Adaptive Immune System CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) sequences were initially...contain a species-specific sequence known as a protospacer adjacent motif (PAM). The CRISPR complex binds...sequence is only valid if it contains a special Protospacer Adjacent Motif (PAM) directly after where the... development has occurred at a truly astonishing pace, with work directed towards increasing on-target...fidelity Cas9 variants , SpCas9-HF, eSpCas9, and HypaCas9 display very low off-target activity due to rationally...SaCas9) is smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs also have distinct PAM ...

...consist of a 20-mer (“protospacer sequence”) upstream of an “NGG” sequence (“protospacer adjacent motif” or...Abstract The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated...Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer sequence and PAM happen to fall on the bottom...bottom (Crick) strand while sgRNA-B’s protospacer sequence and PAM fall on the top (Watson) strand ( Figure...will occur independent of orientation of the protospacer sequence/PAM relative to the top or bottom strand...However, if the first position of the 20-mer (protospacer sequence) is G, do not add another G ( e.g., ...cleavage site to ensure detection would not be impacted by a small indel at the sgRNA target site. Design...

... Viral Vector Packaging Service AAV University of Florida Serotype Testing...Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype Testing... directly to the brain parenchyma or subretinal space Serotypes The following serotypes were developed...acknowledge Shannon Boye and cite Boye, et al. 2016. Impact of Heparan Sulfate Binding on Transduction of Retina...32304666 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

...remain in the laboratory. When traveling between lab spaces, take your glove off of one hand and use your bare...

...1,000 active makerspaces around the world. Hackerspaces.org maintains a list of active spaces near you. ...@derekja  Resources Hackerspace Website https://wiki.hackerspaces.org/Hackerspaces OpenWorm Project Website...manifested itself in the creation of Hackerspaces and Makerspaces back in 2007, which function as centres...with the OpenWorm Project One such space is the Victoria Makerspace in Canada, which I belong to. The ...  Funding Makerspaces One of the main challenges when starting a new project at a makerspace is finding... can find a makerspace somewhere near you. The place to start looking for your local space is the Hackerspace...competition. In 2010, he founded makerspace.ca, Victoria’s first hackerspace which now offers members and ...

... (AAV) available from Addgene's viral vectory packaging service. Browse constructs currently available... Viral Vector Packaging Service AAV Browse In-Stock AAV Adeno-associated virus (AAV...can't find the prep you need, try Addgene's AAV Packaged on Request service. You can choose a transfer ...transfer plasmid from our repository and request packaging in one of five serotypes (AAV1, AAV2, AAV5, AAV8, ... For more information, visit our Viral Vector Packaging Service overview. Function Chemogenetics DREADDs...

...Browse Lenti Packaged on Request Can't find what you need in our in-stock preps? Our Packaged on Request...the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information Production... Viral Vector Packaging Service Addgene produces high-quality viral vector...

...Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus...leukemia virus, and vesicular stomatitis virus G) are packaged as replication-defective virus particles with ...SARS-CoV-2 and other coronaviruses using appropriate packaging plasmids. Use the search bar to find a particular...-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that...

... take a look at the RSpace ELN.  The connected approach in action: how the RSpace ELN supports reproducibility...repositories. RSpace has been integrated with two of the five: Figshare and Dataverse, as well as the DSpace repository... reproduce an experiment documented in RSpace using the RSpace datasets deposited in Figshare or Dataverse...Rory is founder and CEO of Research Space, which provides the RSpace electronic lab notebook. Rory is based...contributed by Rory Macneil, founder of Research Space. There are many types of electronic lab notebooks...reproducibility RSpace was designed in response to requirements that emerged from intensive engagement with...byproduct of connectivity. Between 2012 and 2017 RSpace was developed with these principles in mind, and...

...generation packaging systems use 3 plasmids; an envelope plasmid that usually encodes VSV-G, a packaging plasmid...lentiviral packaging systems please see Addgene’s Lentiviral Guide. While the third generation packaging systems...requirement for additional DNA can impact the transfection efficiency of the packaging cell line and thereby affect...are transfected into a packaging cell line, usually a derivative of 293T. Packaging cells are incubated ...delivering genes via lentivirus is deciding what packaging system is best for a particular experiment. The...The newer generation lentiviral packaging systems were designed to prevent the formation of replication...reduce the risk of such events, newer lentiviral packaging systems divide the viral elements among multiple...

...lentiviruses the same thing? Can I package lentivirus with retroviral packaging plasmids (and vice versa)? A1...plasmids can be packaged with either system. Please note that the generation used to package the virus does...co-transfecting three essential ingredients: the lentiviral packaging vector, a transfer vector including the gene of... an envelope. Three generations of lentiviral packaging systems have been developed over the years based...most experiments; however, the 3rd-generation packaging systems offer the maximal biosafety available ...different plasmids into the producer cells (two packaging plasmids, an envelope plasmid, and the lentiviral...and gamma-retroviruses use the same genes for packaging (that's gag, pol, and env), the isoforms of these...

...at a lower voltage. You will want to have enough space around each band to cut without having DNA in other...

...bath, and be sure to know what the maximum fill capacity is. Look for a “fill” line inside the water bath...

...personal protective equipment, setting up a clean workspace, and maintaining sterility while working. AAV ...

...protein Selectable markers Viral expression and packaging Reporters, shRNA expression, transgenics and ... lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS... expression under the metallothionein promoter pACU2 - Modified pUAST vector containing...InvivoGen trademark. Back to Top Viral Expression and Packaging Although transient expression is sufficient for...extensive collection of plasmids for packaging and expression. See our dedicated lentiviral plasmid...

...receive your Packaged on Request prep 6–9 weeks after placing your order.  Can I order Packaged on Request...expanding our viral vector service to include a Packaged on Request option. Through this expansion, scientists...Figure 1: The process of requesting and ordering a Packaged on Request viral vector prep.    Excited? ...in the Addgene repository will be available for Packaged on Request service. A small subset of AAV plasmids...launch, we will offer five different serotypes for packaging: AAV1, AAV2, AAV5, AAV8, or AAV Retrograde (AAVrg...expansion happen?  You will be able to request Packaged on Request service starting in January 2025.  ...requestors.  Requesting Plasmids available for Packaged on Request consideration will have a banner on...

... Viral Vector Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics ...Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus Constitutive 1, 9... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...

...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....

...of three plasmids: the packaging, envelope, and transfer plasmids. The packaging plasmid carried a mutated...Advantages of lentivirus include a large genetic capacity and the ability to transduce both dividing and...mutated HIV-1 provirus that couldn’t package itself due to a few missing proteins. The envelope plasmid ...terminal repeats (LTRs) that facilitate viral packaging and host genome integration. After co-transfection...the brain (Figure 1). 2nd generation lentiviral packaging system The graphic below shows how the lentiviral... infect CD4+ cells. 3rd generation lentiviral packaging system Although the 2nd generation system is safer...virus via recombination between the transfer and packaging plasmids does exist. To further reduce this possibility...

... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service: Caltech...CAP-B22 AAV9-X1.1 As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use...window) Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...