Skip to main content
Addgene
Showing: 21 - 40 of 1035 results
  1. Promoters

    Type
    Guide
    ...Description CMV Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian... factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter ...Description T7 Constitutive but requires T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires...Inducible Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression... simpler than eukaryotic transcription bacteria still have complex systems of gene regulation, like operons...polymerase Promoter from Sp6 bacteriophage lac Constitutive in the absense of lac repressor (lacI or lacIq...
  2. Chemogenetics Guide

    Type
    Guide
    ... Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima &...vivo and the receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs...insensitivity to endogenous ligands, have low constitutive activity, and their activating ligands have ...G-protein and activate neuronal firing through stimulating phospholipase C, which releases intracellular...This DREADD was shown to have a small amount of constitutive activity, and is not widely used. There is also... also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins...Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U (2016). Luminopsins...
  3. Molecular Biology Reference

    Type
    Guide
    ...thousand basepairs from the entire human genome. Digesting the human genome with restriction enzymes would...amplified) by bacteria, which is an important characteristic of why plasmids are convenient and easy to ...survive antibiotic treatment. It is important to distinguish that the antibiotic resistance gene is under ... easy insertion of DNA by restriction enzymes digestion and ligation. In expression plasmids, the MCS ...can be used for cloning by restriction enzyme digestion. For more information about restriction enzymes...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements...gram-negative, rod shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally...
  4. Lentiviral Guide

    Type
    Guide
    ...insert to recombine with the destination vector (in this case the destination vector would be the lentiviral.... Viral Production Schematic Frequently Asked Questions (FAQ) about Lentiviral Plasmids What is the difference...using PCR. The process of subcloning consists of digesting the insert of interest from its parent vector ...lentiviral transfer vector). The destination vector contains attB sequences with which the attP sequences ...office can provide more information on your institution's best practices with regard to lentiviral research...post‐transcriptional regulatory element; sequence that stimulates the expression of transgenes via increased nuclear...generation vectors use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates...
  5. Plan Your Experiment

    Type
    Guide
    ...such cases, it may be necessary to customize an existing reagent to suit your needs. Genetic Manipulation...expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); ...genetic knockouts, gRNAs commonly target 5′ constitutively expressed exons, which reduces the chances ...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...desired edit, as a large percentage of DSBs are still repaired by NHEJ. How do you determine that your...
  6. Retrovirus Guide

    Type
    Guide
    ...retroviral packaging systems and commonly asked questions... Packaging Systems Frequently Asked Questions (FAQ) Glossary γ-Retroviral Packaging Systems The widespread...Packaging Methods Return to Top Frequently Asked Questions (FAQ) about γ-Retroviral Plasmids How do engineered...post‐transcriptional regulatory element; sequence that stimulates the expression of transgenes via increased nuclear...
  7. Sequencing Primers

    Type
    Guide
    ... sequencing primer" and "3' sequencing primer". Still not sure what primer you need? Email us at [email protected] GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA...
  8. Adenovirus Guide

    Type
    Guide
    ...Components Vector Construction Frequently Asked Questions (FAQ) Glossary Adenoviral Components The adenovirus...Packaging Methods Return to Top Frequently Asked Questions (FAQ) about Adenoviral Vectors Are adenovirus ...
  9. Science Guides

    Type
    Guide
    ...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...
  10. Biosensor AAV Preps

    Type
    Collection
    ...iAChSnFR none Constitutive 1 Looger 137955 pAAV.CAG.iAChSnFR CAG iAChSnFR none Constitutive 1, 9 Looger ... none Constitutive 1, 5, rg* Looger 176753 AAV-mDlx-jGCaMP8f-WPRE Dlx jGCaMP8f none Constitutive 1, 9,...jGCaMP8f none Constitutive 1, 9 Looger 179254 AAV-CAG-jGCaMP8f-WPRE CAG jGCaMP8f none Constitutive 1, 9, rg...ribo-jGCaMP8s none Constitutive 1 Fyhn 169256 AAV-hSyn-Soma-jGCaMP8s Syn soma-jGCaMP8s none Constitutive 1, 9, rg...none Constitutive 1, 5, 9, rg* Looger 176755 AAV-mDlx-jGCaMP8s-WPRE Dlx jGCaMP8s none Constitutive 1, 9...jGCaMP8s none Constitutive 1, 9 Looger 179256 AAV-CAG-jGCaMP8s-WPRE CAG jGCaMP8s none Constitutive 1, 9, rg...ribo-jGCaMP8m none Constitutive 1 Fyhn 169257 AAV-hSyn-Soma-jGCaMP8m Syn soma-jGCaMP8m none Constitutive 1, 9, rg...
  11. Control AAV Preps

    Type
    Collection
    ... gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, rg*...hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462...GFA104 EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru... NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, ...CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson...TBG none Constitutive 8 Wilson 105541 pENN.AAV.CamKII0.4.eGFP.WPRE.rBG CamKII EGFP Constitutive 1, 5 Wilson...pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP Constitutive 8 Wilson 105542 pENN.AAV.CB7.CI.eGFP.WPRE.rBG CB7 EGFP Constitutive 1, 2, 5, 8...
  12. Optogenetics AAV Preps

    Type
    Collection
    ...Venus Constitutive 1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, ...t) mScarlet Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden... ChETA EYFP Constitutive 9 Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 EYFP Constitutive 1, 5, 9, PHPeB...EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 5 Deisseroth...dependent Flp dependent Cre and Flp dependent Constitutive Serotype AAV1 AAV2 AAV5 AAV8 AAV9 AAVrg PHPeB...135634 pAAV-S5E2-ChR2-mCherry nEF ChR2 mCherry Constitutive 1, 9, PHPeB Dimidschstein 137142 pAAV-nEF-Con...pAAV-CaMKIIa-hChR2(H134R)-EYFP CaMKII ChR2/H134R EYFP Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(...
  13. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...amino acid linker ACA Heterotrimeric construct consisting of Amber-5aa linker-Cerulean-6aa linker-Amber...linker-Amber ACV Heterotrimeric construct consisting of Amber-5aa linker-Cerulean-6aa linker-Venus VCA Heterotrimeric...Heterotrimeric construct consisting of Venus-5aa linker-Cerulean-6aa linker-Amber VCV Heterotrimeric construct...construct consisting of Venus-5aa linker-Cerulean-6aa linker-Venus ACAV Heterotetrameric construct consisting... linker-Venus ACVA Heterotetrameric construct consisting of Amber-5aa linker-Cerulean-5aa linker-Venus... linker-Amber VCAA Heterotetrameric construct consisting of Venus-5aa linker-Cerulean-5aa linker-Amber... linker-Amber VCVV Heterotetrameric construct consisting of Venus-5aa linker-Cerulean-5aa linker-Venus...
  14. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...activity (GCaMP6f/m/s) (Constitutive or Cre-dependent) Cell-specific restoration of stimulus preference after... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...a biosensor in a novel context or modifying an existing construct, as fluorescence properties can be affected...Fast Genetically Encoded Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded...High-performance GFP-based calcium indicators (Constitutive or Cre-dependent) High-performance calcium sensors...calcium sensors for imaging neural activity (Constitutive or Cre-dependent) Ultrasensitive fluorescent...regulatory element Viral manipulation of functionally distinct interneurons in mice, non-human primates and humans...
  15. TALEN Plasmids and Kits

    Type
    Collection
    ...pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination constructs were designed...TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-ELD-Destination Golden Gate TALEN 2.0...pC-GoldyTALEN and RCIsricpt-GoldyTALEN are designed as destination vectors for the Voytas lab Golden Gate TALEN ...-BB and pTAL6-BB are designed as alternative destination vectors for the Golden Gate TALEN kit (Bogdanove... pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs built into this vector....several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available with homodimeric or enhanced...accessory pack contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based...
  16. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...p15TV-L EF456736 Hexahistidine tag with TEV cleavage, AmpR 26093 pET15-MHL EF456738 Hexahistidine tag with TEV...GST-tag and hexahistidine tag with Thrombin cleavage, KanR 26096 pET28-MHL EF456735 Hexahistidine tag with...26117 pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106 Hexahistidine tag with TEV cleavage...EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-TrxT GU269914 Hexahistidine tag, thioredoxin...GU452710 Hexahistidine tag , Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with...TEV cleavage, AmpR 26094 pET28a-LIC EF442785 Hexahistidine tag with Thrombin cleavage, KanR 26101 pET28GST-LIC...ptac promoter, AmpR 26099 pFBOH-LIC EF456740 Hexahistidine tag with Thrombin cleavage, Bac-to-Bac Baculovirus...
  17. NETRF

    Type
    Collection
    ...NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution NETRF Project...Meyerson Dana-Farber Cancer Institute Finding the Causes of Small Intestinal Neuroendocrine Tumors Ramesh...Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid...Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Bradley Bernstein Broad Institute Identifying...Project Title Hans Clevers Hubrecht Institute Modeling Neuroendocrine Tumors Using Adult Stem Cell-Derived...Identifying Altered Epigenetic States and Drivers in Intestinal Carcinoid and Pancreatic Neuroendocrine Tumors...
  18. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC20661 CSF1 colony stimulating factor 1 (macrophage) MCSF, MGC31930 CSF1R colony stimulating factor 1 receptor...CSF3 colony stimulating factor 3 (granulocyte) G-CSF, GCSF, MGC45931 CSF3R colony stimulating factor 3 receptor...LXA4R FSHB follicle stimulating hormone, beta polypeptide - FSHR follicle stimulating hormone receptor FSHRO...PTP, REG RETN resistin ADSF, FIZZ3, MGC126603, MGC126609, RETN1, RSTN, XCP1 RETNLB resistin like beta FIZZ1...MGC141920 TSHB thyroid stimulating hormone, beta CHNG4, TSH-BETA TSHR thyroid stimulating hormone receptor ...inducible - VIP vasoactive intestinal peptide MGC13587, PHM27 VIPR1 vasoactive intestinal peptide receptor 1 ...presenting its cognate antigen along with co-stimulation activates the T cell, whereas T cell tolerance...
  19. Bacterial Expression Systems

    Type
    Collection
    ... well understood biology to answer many interesting questions. Does my transcription factor bind to a ...plates lacking histidine and containing 3-AT Scot Wolfe Bacterial one-hybrid system for testing transcription...study it in vitro ? These, in addition to many questions about bacteria themselves, can be answered using...and/or alter cellular activity in a way that’s interesting from an applied perspective, sometimes it’s best...and C-terminal Strep, His, MBP, TRX, GST, SUMO, MISTIC, and LSL tags as well as tags for protein localization...Controlled Expression It isn’t always beneficial to constitutively express your gene of interest at high levels...contains plasmids with various combinations of constituitive promoters and translation initiation elements...
Showing: 21 - 40 of 1035 results