We narrowed to 33 results for: U6...
-
TypeBlog Post...transcribe small RNAs. The most common promoters are U6, H1, and 7SK. These are strong promoters with no ...
-
28 Hot Plasmid Technologies from 2015
TypeBlog Post...cDNA expression, sgRNA (U6) expression, shRNA/shRNA-miR30 constitutive (H1, U6, 7SK) or inducible shRNA-miR30...of the available sgRNA-cargo constructs utilize a U6 promoter and contain the RNA cargo cassette inserted... -
Sequencing Primers
TypeGuide...LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev CCTTATGCAGTTGCTCTCC...LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC... forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA... TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab) Human U6 promoter, forward primer Ubx-F AACTCGTACTTTGAACAGGC... -
Promoters
TypeGuide...Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...www.addgene.org/10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription... -
CRISPR Plasmids - C. elegans
TypeCollection...47549 pDD162 (Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein 42250 DR274 T7 BsaI In vitro transcription... -
CRISPR References and Information
TypeCollection...and BsmBI site for cloning in gRNA: pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF, 49 KB Vosshall... -
Retrovirus Plasmids
TypeCollection...and Neo resistance Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 ... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...of the 20-mer is not G. sgRNA expression from the U6 promoter of the pX330 vector is enhanced by the inclusion... for each sample and sequence each colony using a U6 promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated... -
Luciferase Plasmid Collection
TypeCollection...Luciferase Type Promoter Description PI 60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla... -
27 Hot Plasmids from 2016
TypeBlog Post...backbone, which expresses the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene...