...-NGG PAM sequences include: xCas9 - NG, GAA, and GAT; increase nuclease fidelity SpCas9-NG - NG; increase...VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA); SaCas9... used for small precision edits. NHEJ directly ligates the break ends without the need for a homologous...system, CRISPRi is introduced into bacteria using conjugation and stably integrated into the chromosome. Browse...CJ) 3' NNNNRYAC Neisseria meningitidis (NM) 3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema...). Unraveling the mechanisms of PAMless DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1)...on the consecutive binding and degradation of negatively supercoiled invader DNA by cascade and CAS3. ...

... Protocols Centrifugation Centrifugation Protocol Intro to the Lab Bench Check...centrifuge. Immediately stop the centrifuge and investigate the issue. When you are finished spinning your...

... Protocols Ligation Independent Cloning Ligation Independent ...Overview Ligation Independent Cloning (LIC) obviates the need for the time-consuming ligation step of ...Protocol for Ligation Independent Cloning Protocols...fragments, allowing for transformation without ligation. Because of its dual polymerase/exonuclease functions...mixture, and may provide counter-selection for negative clones as in the example shown here. The manufacturer...

...Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient Ultracentrifugation You may also...Follow this protocol using Iodixanol gradient ultracentrifugation to get pure adeno-associated virus (AAV) ...Data Figure 1: Iodixanol gradient before ultracentrifugation. The steps are clearly distinguishable thanks... 2: Left panel: Iodixanol gradient after ultracentrifugation. The arrow indicates the 60–40% interface...

... For trickier ligations (such as ligation of annealed oligos) the efficiency of ligation can be improved... Protocols DNA Ligation DNA Ligation You may also like... Plasmid...transformed into bacterial cells for propagation. The majority of ligation reactions involve DNA fragments ...ultimately are fused by the ligation reaction. The example below depicts the ligation of two sticky ends that...orientation and prevents the vector from ligating to itself during the ligation process. If the sticky ends on ...: Standard Insert + Vector DNA Ligation Before setting up the ligation reaction itself, it is important...use for the ligation reaction. The volume of vector DNA and insert DNA used in the ligation will vary depending...

...TAL3079 TGGAAAGCGATGATGACGaagtgacaaacaaaacATGGGTTCTGACTCCCAA gata2b TAL3080 & TAL3081 TCAATGTGTCGACCTCACcttatcaacactcacgGTCTTCCTTTACTGGACA...ahcyl1 TAL3018 & TAL3019 TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA amh TAL3210 & TAL3211 TCCAGGCAAGATTTGGGCtgatgctgatgatgacCGTGGCGATTGGGTCGTA...Aminopeptidase-o TAL3020 & TAL3021 TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA... TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA...apoeb TAL3402 & TAL3403 TGCCAGGCTCGTAGCCTGttccaggctgatgccccTCAGCCCAGATGGGAGGA arap3a TAL3026 & TAL3027...TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA ARSA TAL 3002 & TAL 3003 TCAAGAGGCGGTCTCCCTctcaacgagaccaccaTAGCCGAGGTGCTGAAGA... asun TAL3404 & TAL3405 TAACTCAAGCCAACTCCAggaaacatcaggagtttGCAGGAAGATTGAGTTCA atf6 TAL3406 & TAL3407 TCCAACCAGCAAAAAGACccatccaggtgtgccccaAGGTTTCCATTCAGCCTA...

...victoria GGTGGTGCAGATGAACTTCA 47513 cut S. pyogenes 23792628 Joung EGFP A. victoria TGAAGAAGATGGTGCGCTC 58255...scrofa CTTTCGGATATAATCCACGG 69801 cut S. pyogenes 26293209 Zhao mitfa D. rerio GGTCTCTCGCAGGATGTTGC 47931...Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes 25240928 Lu negative control CTGGAATGAATTGGCCTATG...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...Christiaen negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control...sapiens GATACTGGAGAAGCAGGGGC 68466 cut S. pyogenes 26145478 Zhang PAX6 H. sapiens GTAGATTTTGTATGCACTGC 68465...gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes 25480939 Sibley th D. rerio GGATGCGCGTAAGGAGCGCG 42247...

...components can interfere with the conjugate or conjugation process. Sodium azide, an antimicrobial agent,... back to buffers after the conjugation reaction is complete. HRP-conjugated antibodies should not be stored...done through a conjugation reaction. Many antibodies can be purchased already conjugated, which can save...you want is not available pre-conjugated, or is not available conjugated to your signaling molecule of...indirect detection method uses an unconjugated primary antibody and a conjugated secondary antibody specific...well plate. A conjugated primary antibody is used to bind to the antigen and the conjugate, typically HRP...indirect sandwich method, a conjugated secondary antibody is added. The conjugate is activated and the output...

...Bacterial (pET), Gateway GTPase Arl4c 10123 201/192 Gateway GTPase Arl4d 379 201 Gateway GTPase Arl5a 26225...(pET), Gateway GTPase Arl8a 127829 186 Bacterial (pET), Gateway GTPase Arl8b 55207 186 Gateway GTPase ...pcDNA3), Gateway GTPase Sar1a 56681 198 Bacterial (pET), Gateway GTPase Sar1b 51128 198 Gateway GTPase ... pCAG), Gateway GEF Arfgef2 10564 1785 Mammalian (pCAG), Gateway GEF Iqsec1 9922 1114 Gateway GEF Iqsec2...9267 398 Gateway GEF Cyth2 9266 400 Mammalian (pEGFP-C1), Gateway GEF Cyth3 9265 399 Gateway GEF Cyth4...Mammalian (pcDNA3), Gateway GTPase Arf3 377 181 Bacterial (pET), Mammalian (pcDNA3), Gateway GTPase Arf4 378...Mammalian (pcDNA3), Gateway GTPase Arf5 381 180 Bacterial (pET), Mammalian (pcDNA3), Gateway GTPase Arf6 382...

...rather than two. Stephen Ekker Golden Gate TALEN 2.0 Golden Gate cloning method. Validated in multiple...compatible with Golden Gate TALEN and TAL Effector Kit 2.0. Stephen Ekker Platinum Gate TALEN Kit Platinum...activities in cultured cells. Golden Gate TALEN 2.0 47388 pcDNA3.1-GoldenGate Charles Gersbach These new destination...VP16) at the C terminus. 47389 pcDNA3.1-GoldenGate-VP64 Golden Gate TALEN 2.0 47874 pTALYM3 Maria-Elena Torres-Padilla...destination vectors for Voytas Golden Gate-assembly kit. 47875 pTALYM4 Golden Gate TALEN 2.0 48705 pTAL7a Boris...System Contains 336 pFusX clones allowing for Golden Gate assembly of 15-16 RVD TALEN inserts in one cloning...Effector Engineering Reagents Assembly via serial ligation. Validated in zebrafish somatic cells. Keith Joung...

...-ccdB - Yeast Gateway expression vector (see more Gateway vectors) TRP1 ...-ccdB - Yeast Gateway expression vector (see more Gateway vectors) LEU2 ...-ccdB - Yeast Gateway expression vector (see more Gateway vectors) HIS3 ...-ccdB - Yeast Gateway expression vector (see more Gateway vectors) Zeocin...plasmids for mammalian expression, Ligation Independent Cloning (LIC) Bacteria Lac, T7, araBAD... experiments Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination vectors - Inducible...Easy cloning of your gene using Gateway recombination Back to Top Epitope Tag or Fusion...

...OPEN OPEN cACCTGCAGCagattGAAGAAGAGg cftr OZ517 and OZ518 OPEN OPEN gTGCAACCGCagctttTAGGACGGAt fox1 (a2bp1l...OPEN OPEN gCCCCTCAGCccagatgGGAGGAGATg dpf2 OZ531 and OZ532 OPEN OPEN cTGCTACTTCtggatGGAGAAACGa pitx2 OZ533...CODA CODA gTCCAGCAGCGGTGAGGATGAAGACg unc119b OZ581 and OZ582 CODA CODA tTGCTGCCGCGGATGCTGTGGCGGTTa cx52.9...half-site CACNA1F OZ507 and OZ508 OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg xylt1 OZ509 and OZ510 OPEN OPEN cACCCTCTACaggacaGTAGCGGGTg...gpcr-2037) OZ535 and OZ536 OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa...Gene (sbds) OZ545 and OZ546 OPEN OPEN tGTTGCCGTCgtgagGATGAAGAAa CACNA1D (2of2) or cav1.3b OZ547 and OZ548...corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa cdkn1a (p21) OZ555 and OZ556 OPEN OPEN...

...Luciferase-containing plasmids are commonly used to investigate the effect of regulatory elements, such as promoters...both Renilla and Firefly luciferase. Plasmids are Gateway cloning compatible. Learn more about DULIP in our... into a Firefly luciferase reporter vector via Gateway cloning to test for the presence of transcriptional...Bartel 101139 pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF) Firefly/Renilla Creating...212936 pGL3 Basic Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz...Insertion of 5' promoter/enhancer regions using Gateway cloning. Lentiviral. Jorge Ferrer 87067 pcDNA3.1...® Creation of N-terminal Nanoluc fusions using Gateway cloning Mikko Taipale 87075 pLenti6.2-ccdB-Nanoluc...

...also available as Gateway donor vectors [48218~48221] and can be transferred to Gateway destination vectors...dCas9 Activators Gateway Donors ID Plasmid 48214 pAC1-pCR8-dCas9VP48 : dCas9VP48 on Gateway donor vector ...dCas9 on Gateway donor vector pCR8/GW/TOPO. 48219 pAC147-pCR8-dCas9VP64 : dCas9VP64 on Gateway donor vector...dCas9VP96 on Gateway donor vector pCR8/GW/TOPO. 48221 pAC149-pCR8-dCas9VP160 : dCas9VP160 on Gateway donor vector.../TOPO. Table 4. Gateway Destination Vector ID Plasmid 48222 pAC90-pmax-DEST : Gateway Destination vector... (Link opens in a new window) Lifetechnologies Gateway Destination Vectors ) to adapt to different systems...

...required. pET-HIS-Sangamo 40786 TALEN Gang Bao Gateway cloning and expression of an N-terminally His-tagged...endonuclease domain. pET-Sangamo-His 40787 TALEN Gang Bao Gateway cloning and expression of a C-terminally His-tagged...N-terminal 6x His tag and an MBP tag. Compatible with Gateway cloning. pDEST-periHisMBP 11086 Tac (lactose/IPTG...formation or prevent toxicity. Compatible with Gateway cloning. pGTvL1-SGC 39188 pTac (lactose/IPTG inducible...fragment that includes the SacB gene, allowing for negative selection on 5% sucrose. Other empty vectors for...RK2 origin suitable for replication in many gram-negative hosts. pCri System Various Plasmids T7/lacO and... proteins for studying gene expression in Gram-negative bacteria. pAK Series Various Plasmids pTac GFP...

...construct using Golden Gate assembly. Gersbach MuLE System Mammalian MultiSite Gateway recombination-based...Cas9 vectors in one round of cloning by Golden Gate ligation or Gibson Assembly Liu A CRISPR/Cas9 toolbox... plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly...for assembly of gRNA cassettes using Golden Gate ligation into Tol2-based pGGDestTol2LC vector. Uses five...nuclease/nickase expression cassette using the Golden Gate cloning method. A separate accessory pack is available...expression cassettes can be assembled using Golden Gate cloning or the Gibson Assembly. Chen Boosting CRISPR...a single T-DNA binary vector of choice through Gateway recombination. Qi Multiplex Conditional Mutagenesis...

...1 PX458_FOXP1_2 GATAD1 Human FLAG pFETCh_GATAD1 PX458_GATAD1_1 PX458_GATAD1_2 GATAD2A Human FLAG pFETCh_GATAD2A...pFETCh_GATAD2A PX458_GATAD2A_1 PX458_GATAD2A_2 HHEX Human FLAG pFETCh_HHEX PX458_HHEX_1 PX458_HHEX_2 HBP1...

...microscopy after negative staining. Empty vector particles can be identified after negative staining and ...preparations are purified by iodixanol gradient ultracentrifugation and concentrated to purity and titers adequate...final vector preparation, the quantity of gram-negative bacterial endotoxin is ensured to be less than...containing lentivirus is first cleared by low-speed centrifugation and then by filtration through a 0.45 µm polyethersulfone...possible, all plasmids used for viral production are propagated in the endA -mutated NEB Stable strain of E. ...

...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Anderson Lab Plasmids and Phagemids Balazsi Lab Negative Autoregulation and Yeast-Mammalian Circuit Transfer...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit...Fluorescent Proteins FREQ-Seq Kit FX Cloning Kit GreenGate Cloning System (Plant) MoClo Modular Cloning Modular...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium...

...same reaction which ligates a promoter into an empty backbone can be repeated to ligate your gene of interest... 21) Prefix: GAATTC ATG AGATCT Prefix Enzymes: EcoR1 , BglII Suffix: T GGATCC TAA CTCGAG Suffix Enzymes...Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser in-frame with prefix start codon; Employs...