We narrowed to 565 results for: nol
-
TypeCollection...capacity to give rise to an entire organism. iPSC technology removes the possible ethical concerns related...tumorigenicity, an inherent disadvantage of iPS cell technology. Browse Addgene's collection of Transdifferentiation... lineage conversion of acinar cells. Nature Biotechnology. 2014 Dec;32(12):1223-30. Zhou Astrocytes Dopaminergic...oligodendroglial cells by direct lineage conversion. Nat Biotechnol. 2013 May;31(5):434-9. Wernig Fibroblasts Oligodendrocyte...myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol. 2013 May;31(5):426-33. Tesar Fibroblasts Medium...fibroblasts into antigen-presenting dendritic cells. Sci Immunol. 2018 Dec 7;3(30). pii: 3/30/eaau4292. Pereira ...
-
Lentivirus Plasmids
TypeCollection... used with 2nd and 3rd generation lentivirus technologies. ID Plasmid Generation Type Description PI 12253...-G recommended for the FELIX (FIV-based) system Nolan 22502 pCEP4-tat N/A Packaging Expression of tat;... FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing... used with 2nd and 3rd generation lentivirus technologies. Looking for lentiviral plasmids to express ...gene of interest) can be cloned into the plasmid. Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene... -
Zhang Lab CRISPR Page
TypeCollection...trans-activating crRNA (tracrRNA; Hsu et al ., Nature Biotechnology 2013). We also have an older system using two...express up to three sgRNAs (Swiech et al., Nature Biotechnology 2014). Full references are below. Available ...mouse CRISPR-Cas9 is a versatile genome editing technology for studying the function of genetic elements...Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat Biotechnol. 2013 Sep;31(9):827-32. doi: 10.1038/nbt.2647...Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6. doi: 10.1038/nbt.3055... -
Water Bath Protocol
TypeProtocol...the lab. Equipment Water Bath 10% bleach or 70% ethanol Distilled water Disinfectant Thermometer Water ...water. You may use a 10% bleach solution or a 70% ethanol solution to wipe down the inside of the water bath...marker that is also resistant to chemicals such as ethanol. Writing on the tops of the tubes and lids of items... -
Video Library
TypeProtocol...produced in mammalian cells AAV Purification by Iodixanol Gradient Ultracentrifugation Protocol Mulitchannel...preparation. AAV Titration by qPCR Using SYBR Green Technology Protocol Agarose Gel Electrophoresis Gel electrophoresis... process when requesting samples from Addgene Technology Transfer How to Order A step-by-step walkthrough... -
Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps
TypeProtocol...use Watch the Video! DNA Purification Miniprep, phenol-chloroform extract, and precipitate DNA DNA Quantification...the target of your choice AAV Purification by Iodixanol Gradient Ultracentrifugation Purify adeno-associated...Video! AAV Titration by qPCR Using SYBR Green Technology Use qPCR to measure the physical titer of your... -
Validated gRNA Sequences
TypeCollection...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...England Biolabs Cell-Imaging Plasmid Collection Technology Plasmids Supplemental Information New England...fixed cells. The plasmids associated with this technology are available at Addgene for distribution to ...NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag SNAP-tag is based on the human O6-alkylguanine-DNA-alkyltransferase... -
Antibody Plasmid Collection
TypeCollection...monoclonal antibody fragments by phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas...and utilisation of recombinant antibodies. BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system...selected from Tomlinson I+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody... -
Microbiology Resources
TypeCollection...units in the oleaginous yeast Y. lipolytica - Rossignol Lab Yeast Gateway kit : 285 vectors for expression...CRISPR Guide for a general introduction to CRISPR technology. Check out our CRISPR reference page for CRISPR...resources Bacterial CRISPR Resources The CRISPR technology was developed from bacterial immune systems, ... -
Plant Plasmids and Resources
TypeCollection...spanning a wide variety of molecular biology technologies: from genome engineering and gene regulation...CRISPR Guide for a general introduction to CRISPR technology or the Plant CRISPR Resources for a full selection...initiative promotes interdisciplinary exchange, open technologies, and responsible innovation for improvement ... -
Zebrafish Plasmid Collection
TypeCollection...CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR resources for a full ...zebrafish resources and developing new lines and technology. European Zebrafish Resource Center (EZRC) - ...- A repository at the Karlsruhe Institute of Technology (KIT) for the distribution of zebrafish lines ... -
Rett Syndrome
TypeCollection... Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach for precise...CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources for a full ...Anti-MECP2 (D4F3) rabbit antibody from Cell Signalling Technology Additional Resources (Link opens in a new window... -
Plan Your Experiment
TypeCollection...more information on the wide range of CRISPR technologies, visit our CRISPR Guide . There are many different... for CRISPR-Based genome editing. Trends in Biotechnology , 36 (2), 173–185. https://doi.org/10.1016/j.tibtech... analysis of CRISPR–Cas experiments. Nature Biotechnology , 38 (7), 813–823. https://doi.org/10.1038/s41587... -
Neurodegeneration Plasmid Collection
TypeCollection...CMV Huntington's Arnold Boersma 175061 pQ39-VC HTT Venus, mCherry CMV Huntington's Arnold Boersma 175062...mCherry CMV Huntington's Arnold Boersma 175064 pQ79 HTT mCherry CMV Huntington's Arnold Boersma 175066 pVC-...mCherry CMV ALS Arnold Boersma 175067 pVC-FUS-R521C FUS Venus, mCherry, HA CMV ALS Arnold Boersma 175068...2A Tau WT WPRE MAPT CBA Parkinson's, FTD Matthew Nolan 138134 pT7NT*-Bri2 113-231 R221E ITM2B NT T7 Familial...175068 pFUS-WT-VC FUS Venus, mCherry, HA CMV ALS Arnold Boersma 175307 pH6HTC_HNRNPA1-Halo HNRNPA1 Halo, His... Arrowsmith 211083 pNLF1-C_EIF2B2:1-351 EIF2B2 NanoLuc CMV VWM, CACH Cheryl Arrowsmith 211112 pBiT3.1-... -
Fluorescent Protein Guide: Biosensors
TypeCollection...pentose and disaccharide accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose...indicator for in vitro and in vivo studies. Nat Biotechnol. 2018 Sep;36(8):726-737. Yulong Li Acetylcholine...imaging of endocannabinoid dynamics in vivo. Nat Biotechnol. 2021 Nov 11. pii: 10.1038/s41587-021-01074-4...measurements of membrane charges in live cells. Nat Biotechnol. 2017 Mar 13. Katharina Gaus Endo/Exocytosis ... -
Zinc Finger Consortium Reagents
TypeCollection...research and development of engineered zinc finger technology. Consortium members Keith Joung and Daniel Voytas... nuclease fusions Related Genome Engineering Technologies TALEN Engineering Reagents CRISPR Plasmids... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...rProtein A Gravitrap columns and gently pour off the ethanol storage buffer. Tightly attach LabMate PD10 Buffer...of Protein A/G binding buffer and store in 20% ethanol at 4 °C . Pro-Tip Columns may be re-used up to ... -
Distribution to Industry
TypeCollection...Ordering and MTA Information Featured Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-...distribution. Please see the Sample Agreements on our Technology Transfer Information page for more information... -
Viral Vectors
TypeCollection...genomes have been adapted into a plasmid-based technology, such that plasmids can be used to create viruses...target cell genome integration. Community Resources Nolan Lab Retroviral Systems Trono Lab Lentivector Toolbox...