We narrowed to 30 results for: tfa

1. Tips for Using FRET in Your Experiments

   Type

   Blog Post

   ...important to follow some simple rules to avoid common pitfalls and to use it at its best. What are the Parameters...

2. 3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells

   Type

   Blog Post

   ... the edited cells in our hands, these combined pitfalls made it virtually impossible to find the 0.2-0.5%...

3. PiggyBac-ing Through the Genome Editing Field

   Type

   Blog Post

   ...seamless genetic manipulations, while avoiding the pitfalls common to other approaches. Many thanks to our...

4. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

   Type

   Blog Post

   ...Choosing Your Fluorescent Protein Learn Some of the Pitfalls of Working With Fluorescent Proteins Use FRET ...

5. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

   Type

   Blog Post

   ... of epitope tagging, however, suffer from many pitfalls: they require construction of plasmid vectors ...

6. With an Eye Towards the Future, We Look Back at the March for Science

   Type

   Blog Post

   ...leadership, and raising awareness regarding the pitfalls of accepting alternative facts. Because, similar...

7. Deep Dive: qPCR

   Type

   Blog Post

   ...Walker SJ; Vrana KE. 1999. Quantitative RT-PCR: pitfalls and potential. BioTechniques 26:112–115.Marino...

8. Validated gRNA Sequences

   Type

   Collection

   ...CTTTCGGATATAATCCACGG 69801 cut S. pyogenes 26293209 Zhao mitfa D. rerio GGTCTCTCGCAGGATGTTGC 47931 cut S. pyogenes...

9. Neurodegeneration Plasmid Collection

   Type

   Collection

   ...229743 pPB-EF1A-HALO-hLRRK2 (LIR2 mutant WTFI -> ATFA) LRRK2 Halo EF1-alpha Parkinson's Shawn Ferguson...pPB-EF1A-HALO-hLRRK2 (LIR1+2 mutant WEVL -> AEVA / WTFI -> ATFA) LRRK2 Halo EF1-alpha Parkinson's Shawn Ferguson...

10. Chemogenetics Guide

    Type

    Guide

    ...studies because it is FDA and EMA approved. One pitfall of a suite of muscarinic-based DREADDs that all...