Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 386 results for: Lor;

Showing: 381 - 386 of 386 results

  1. CRISPR Guide

    Type
    Guide
    ...fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging can be achieved by using orthogonal... L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D. W. (2022). Structural basis for mismatch surveillance...Petris, G., Montagna, C., Reginato, G., Maule, G., Lorenzin, F., Prandi, D., Romanel, A., Demichelis, F., ...Zhang, H., Finkelstein, I. J., Johnson, K. A., & Taylor, D. W. (2024). Unraveling the mechanisms of PAMless...Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor CRISPR labeling of chromosomal loci in human ...., Ramos, D., Hibshman, G. N., Wright, J. T., & Taylor, D. W. (2023). Structural snapshots of R-loop formation...

  2. Molecular Biology Reference

    Type
    Guide
    ...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...as a sequencing chromatogram which provides the color and intensity of each fluorescent signal. Sanger...bases and a microscope captures the fluorescent color that is emitted each time a base is added. Again...base (A,C,T, or G) is labelled with a different color making it easy to identify the order of the DNA ...

  3. Modular Cloning Guide

    Type
    Guide
    ...Modular Cloning Chloroplast Toolbox Plant Expression Scott Lenaghan 122 plasmids with chloroplast-specific genetic...

  4. Sequencing Primers

    Type
    Guide
    ...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...

  5. Adenovirus Guide

    Type
    Guide
    ... (Link opens in a new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral...
Showing: 381 - 386 of 386 results