Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 416 results for: Numb

Showing: 381 - 400 of 416 results

  8. Adenovirus Guide

    Type
    Guide
    ...denoted using two numbers separated by a slash (e.g. Ad5/35), where the first number indicates the serotype...serotype of the genome and the second number the serotype of the capsid. Use of these pseudotyped vectors...

  12. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...Determine the number of genome-containing particles in an AAV prep using qPCR, SYBR Green Technology,...Titration protocol can be used to determine the number of genome-containing particles of an AAV prep using... step Reagent Preparation Master Mix: Count the number of samples (n) and prepare master mix for an additional...

  13. Pouring LB Agar Plates

    Type
    Protocol
    ...colonies Pro-Tip If you will be screening a large number of colonies, we recommend using larger plates. ...precise mass you measure out will be based on the number of plates you’d like to pour. For example: Because...down with a paper towel. Count out the appropriate number of plates and stack them on your lab bench. Label...

  14. Lentivirus ddPCR Titration

    Type
    Protocol
    ... transducing units and generally represents the number of infectious viral particles. Users may need to...primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244 Reagent ...1600 To calculate the titers, first calculate the number of viruses per cellular genome: Since the cellular...

  15. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...the entire brain, allowing for an unprecedented number of connections, or the “connectome”, to be visualized...

  16. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...editors with distinct PAM sequences, expanding the number of available target sites for base editing. For...

  18. Molecular Biology Reference

    Type
    Guide
    ...constructed a plasmid, you can easily make an endless number of copies of the plasmid using bacteria, which ...BL21 and its derivatives. We've included a small number of E. coli strains below and recommend checking...

  19. Fluorescence Titering Assay

    Type
    Protocol
    ... {N*F*D\over V_T}$$ Where: T = Titer, TU/mL N = Number of cells transduced F = Fraction of cells with ... = {N*F\over V_V}$$ Where: T = Titer, TU/mL N = Number of cells transduced F = Fraction of cells with ...

  20. Pipetting Protocol

    Type
    Protocol
    ... with the appropriate tips, which are made in a number of sizes and colors depending on the pipette they...Although each pipette performs the same function, the numbers are read differently on each type of pipette. This...
Showing: 381 - 400 of 416 results