We narrowed to 418 results for: Numb

...communication options. Addgene, along with an increasing number of academic labs, uses Slack constantly. Whether...

...Institute. Today's postdoctoral fellows (PFs) face a number of challenges ranging from long periods of training...

...ions across the axon's membrane: once a certain number of positive ions crosses the cell membrane, a threshold...

.... For example, the analysis becomes easier, the number of cells needed is lower, and perhaps most important...

...super-resolution imaging, they still do not emit the large number of photons achievable with photoswitchable dyes...

...objectives. Most systems can only excite and read a set number of excitation and emission wavelengths, as this...

...efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) as a percentage...

...few years, there's been a disturbing trend in the number of high profile people denying science, from celebrities...

...kit offers a broad range of parts, including copy number machinery, chromosomal integration modules, and...

... of optogenetics, has genetically manipulated a number of the opsin genes to alter the light spectrum ...

...manufacturer’s documentation **Varies by plasmid copy number   Pro tip! If you are having trouble getting sufficient...

...cellular mismatch repair contributed to a large number of unintended prime editing outcomes, including...

...employers may file petitions regardless of H-1B visa number availability. In this section we will discuss a...

...Determine the number of genome-containing particles in an AAV prep using qPCR, SYBR Green Technology,...Titration protocol can be used to determine the number of genome-containing particles of an AAV prep using... step Reagent Preparation Master Mix: Count the number of samples (n) and prepare master mix for an additional...

.... The degree of off-target effects depends on a number of factors, including: how closely homologous the...

...colonies Pro-Tip If you will be screening a large number of colonies, we recommend using larger plates. ...precise mass you measure out will be based on the number of plates you’d like to pour. For example: Because...down with a paper towel. Count out the appropriate number of plates and stack them on your lab bench. Label...

... transducing units and generally represents the number of infectious viral particles. Users may need to...primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244 Reagent ...1600 To calculate the titers, first calculate the number of viruses per cellular genome: Since the cellular...

...editors with distinct PAM sequences, expanding the number of available target sites for base editing. For...

...the entire brain, allowing for an unprecedented number of connections, or the “connectome”, to be visualized...

...or blot, Table 1 (at the end of the post) has a number of helpful suggestions.  Gels Gel issues usually...