We narrowed to 460 results for: abo.5

...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo... company: Top oligo: 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG...reverse compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom...Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG GTTAAC - 5' = 28 bp We also need to include additional bases ...oligo, making our final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom...oligo: 3' - G GTATAC AATTAATT CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (...phosphatase treat your cut vector it is necessary to use 5'-phosphorylated oligos. This is an option that can...

...better. The Thomas Kilmann Conflict Model describes 5 basic approaches to conflict resolution based on various...rely on what I know about those particular teams at that given time. I think about how previous iterations...disagreements. In fact, conflict resolution isn’t just about resolving conflicts between other people, but resolving...normally get along well with each other disagree about a specific decision, direction, or goal. Resolving...of lapsed communication. Making some assumptions about how something should be communicated is necessary...confusion around... Ownership: Misunderstandings about who is responsible for what tasks or projects is...conflicts.  Transitioning a conflict into a collaboration may not be the easiest resolution to accomplish...

...Biomedicine to 78 undergraduate/graduate students from 5 independent universities in Spain through 22 international...USA-Europe professional collaborations, setting up bases and contacts with Spanish laboratories to start working...where individuals can exchange ideas, network, collaborate, and innovate internationally. Why an International...needs, and came from the universities mentioned above. The initial IMP cohort of 78 mentees included: ...    Other Resources Visit the IMP website Learn about the Mentor Circle Program at Brigham and Women's...Networking for Scientists Series Read our Blog Post about Choosing a Mentor      ...

...however recognizes a different PAM site and generates 5’ and 3’ staggered ends after dsDNA breaks. The Doudna...Addgene Blog Learn about using toehold switches to detect Zika virus   Learn more about targeting RNA with...time-consuming, and complex to use outside of standard laboratories. In the case of the COVID-19 pandemic, qPCR ...with Cas13a (C2c2) Learn more about Cas12a (Cpf1) and its multiplex genome editing abilities Resources...

...), 4897. https://doi.org/10.1038/s41467-024-49343-5 Tong, H., Wang, X., Liu, Y., Liu, N., Li, Y., Luo,...In our last post, we talked about the first base transversion editors: CGBEs, or C → G Base Editors. ...apyrimidinic sites and abbreviated as AP sites. A collaborative team from the David Liu and Dali Li labs reported... CRISPR 101: Cytosine Transversion Editors Read about four base editor reporters Resources on Addgene.org...

...left-right organizer development. PLoS Genetics, 19(5), e1010765. https://doi.org/10.1371/journal.pgen.1010765... Check out our Optogenetics Guide to learn more about how these modules work, and read on to learn how...to the cell membrane isn’t powerful enough, what about altering the chemical composition of the membrane...

...–297. https://doi.org/10.1016/s0092-8674(04)00045-5 De Rie, D., Abugessaisa, I., Alam, T., Arner, E., ... & Corey, D. R. (2021). Reexamining assumptions about miRNA-guided gene silencing. Nucleic Acids Research...

... concentration: 4 × 10 5 cells/mL To seed one 96-well plate, make 10 mL of a 5 cell/mL solution. Calculate...conditioned medium prepared above to make a new cell solution at a concentration of 5 cells/mL. Prepare approximately...high glucose, add 55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable...0.45 µm PES filter or centrifugation at >500 x g for 5 minutes. Do not use the medium if the cells are overly...this cell solution in fresh complete medium. This 5 cells/mL solution will be used to seed the 96-well...the total cells needed: Total cells needed: 10 mL × 5 cells/mL = 50 cells Determine the volume of homogenized...homogenized cell solution needed: (50 cells)/(4 × 10 5 cells/mL) = 0.125 µL Because this is such a small ...

...targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT ITR Probe...pipette to add 5 µL of each viral sample to Dilution 1 in the 48-well dilution plate and pipette 5–10 times ...time. Dilution 1 (20X): 5 µL in 95 µL 1X PCR buffer (1:20) Dilution 2 (20X): 5 µL in 95 µL 1X PCR buffer...400) Dilution 3 (20X): 5 µL in 95 µL 1X PCR buffer (1:8,000) Dilution 4 (20X): 5 µL in 95 µL 1X PCR buffer...buffer (1:160,000) Dilution 5 (20X): 5 µL in 95 µL 1X PCR buffer (1:3,200,000) Dilution 6 (2X): 50 µL in...dilution series. For dilutions 1–5, use the 1–10 µL multichannel pipette set to 5 µL. For dilutions 6–8, use...PCR tubes. Add 5 µL of dilutions 6–8 to the appropriate PCR tubes. Pipette back and forth 5 times. Lightly...

...oligo) primers, which anneal to the regions upstream (5’) and downstream (3’) of the DNA segment to be amplified...Repeat steps 2-4 25-30 times. Final Extension for 5 minutes at 72°C: A final extension to fill-in any ... tube Ice Bucket 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM...36.8 μL Sterile dH 2 O 0.2 μL Taq DNA Polymerase (5 units/μL) PCR Machine Agarose Gel Procedure Primer...reagents on ice): 2 μL Template DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM...Reverse Primer (10 μM stock) 0.2 μL Taq DNA Polymerase (5 units/μL) 36.8 μL Sterile dH 2 O (variable) Note: ...reaction tubes in PCR machine. Set annealing temperature 5°C below the primer melting temperature (Tm). Set extension...

...genomic DNA. Incubate tube on ice for 5 min. Centrifuge the tube for 5 min at 12,000 g. Notes: Pellet contains...Optional: Add 5 μL of 2 mg/mL RNase A to the supernatant in the new tube and incubate at 37 °C for 5 min. Note...are worried about losing the pellet. Dry with vacuum or by inverting over paper towel for 5-20 min. Resuspend...200 μL of Solution II and invert the tube carefully 5 times to mix the contents. The contents will become...purified plasmid DNA. Incubate solution on ice for 5 min. Add 150 μL of cold Solution III to each tube....microfuge tube for 30-60 sec. Centrifuge the tube for 5 min at room temperature on the highest setting. Note... overnight OR -80 °C for 30 min OR on dry ice for 5 min. Note: This freezing may help the DNA to precipitate...

...stories and read papers wherein a researcher tries 5 separate experiments at once to get confirmatory data...easier to find information about research tools. BenchSci collates information about antibodies while FPbase...variety of additional resources and information about organizations promoting reproducibility in this ...that make it easier to share in-depth information about reagents, protocols, analysis tools, and more. Being...from a freezer. As you’ll see in Steve Almo’s talk about work at the Institute for Protein Innovation (IPI... talked to many researchers who have complaints about the unreliability of antibodies. IPI is working ...FPbase curates information about fluorescent proteins so you can best apply these technologies to your own...

...Nature. 2015 Dec 3. doi:10.1038/nature.2015.18947 5. Siva K, Covello G, Denti MA. Exon-skipping antisense...estimated that very little dystrophin correction (about 4%) is needed to see muscle improvement, with only...diseases we’d like to treat with CRISPR. As seen above, DMD can be treated with “one-size-fits-most” NHEJ-mediated.... Precision genome editing faces the challenges above and more. One chief challenge is upregulating HDR...

...Validation (Uhlen, et al., 2016). This group proposed 5 Pillars of antibody validation which represent five...may not be the most accessible option for many laboratories. Additionally, it can be difficult to distinguish...the captured proteins off for mass spec analysis (above). When the results come back it shows that the majority...our Selecting an Antibody blog post! Learn more about Antibodies and their many applications in our Antibodies...

...in human tissue and in vitro. Oncology Reports, 50(5). https://doi.org/10.3892/or.2023.8631 Tsien R. Y....response-element NanoLuc reporter to show that the mutants abolished transcriptional activity, even in the presence...products offered by Promega. The vectors linked above are ready to request from Addgene so you can combine...

...–203 . https://doi.org/10.1016/0003-2697(81)90281-5 Pillai-Kastoori L, Heaton S, Shiflett SD, Roberts ... the thickness of the band provides information about the relative abundance of the protein in the sample...history, principles, and types of ELISA, and our laboratory experience with peptide/protein analyses using...

...inducing site-specific DNA methylation. Biology Open 5:866–874 . https://doi.org/10.1242/bio.019067 Find...modifications. Like the TALE-LSD1 system described above, dCas9-LSD1 inactivates targeted enhancers. Although...setting up your experimental system. Let us know about your experience with these constructs in the comments...

...restriction site (GAATTC) to the 5’ end of this primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC...consist of: Leader Sequence: Extra base pairs on the 5' end of the primer assist with restriction enzyme ...Therefore, our Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds..., resulting in a final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse...final 18bases of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC...restriction enzyme digestion. This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with...put the sequence we chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this...

...773–779 . https://doi.org/10.1038/s41477-020-0704-5 Santana I, Wu H, Hu P, Giraldo JP (2020) Targeted ... Addgene. In addition to the plasmids described above, Addgene carries several useful CRISPR toolkits ...

...cool down to about 50 °C (about when you can comfortably keep your hand on the flask), about 5 mins. Optional...buffer to each of your DNA samples and mix well. Use 5 µl of loading buffer per 25 µl of sample. Note: Loading...container filled with 100 mL of TAE running buffer and 5 μL of EtBr, place on a rocker for 20-30 mins, replace...replace EtBr solution with water and destain for 5 mins. Using any device that has UV light, visualize your...electrophoresis (PAGE), which is typically used to separate 5 - 500 bp fragments. How do you get better separation...concentration of approximately 0.2-0.5 μg/mL (usually about 2-3 μl of lab stock solution per 100 mL gel). EtBr... of the tip of the pipette into the buffer just above the well. Very slowly and steadily, push the sample...