We narrowed to 422 results for: cript

... Integrative vector assembly of up to three transcription units in the oleaginous yeast Y. lipolytica ...

...search Addgene's entire collection. ID Plasmid Description Gene/Insert PI Plasmids Expressing Worm Genes...

... in a new window) on Promega.com. ID Plasmid Description Industry Plasmid Technology Overview This collection...

...collections or kits are described below . ID Plasmid Description Gene/Insert PI Return to top Highlights of Zebrafish...

...name for ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken...

...proteins fused with linkers of varying lengths. Description Article ECFP-EYFP FRET standards, fusion proteins...

...public folder (Link opens in a new window) of manuscripts that have used these constructs experimentally...

...vector for investigating regions controlling transcription See our Luciferase collection of plasmid backbones...

...non-canonical amino acid incorporation. ID Strain Description PI 48998 C321.ΔA all TAG sites changes to UAG...

...initiation of transcription, whereas transcription factors promote the initiation of transcription. The binding... eukaryotic promoters, including transcription and the transcription complex. Educational... site for the RNA polymerase and transcription factors. Transcription factors are proteins which recruit...TSS = transcription start site. Created with BioRender.com. Operons Although bacterial transcription is ...eukaryotic promoter structure. TF = transcription factor; TSS = transcription start site. Created with BioRender.com...Resources A promoter is a region of DNA where transcription of a gene is initiated. Promoters are a vital...codons and whose sequence corresponds to the mRNA transcript produced. The antisense strand is referred to...

...Targeting dCas9 to transcription start sites is sufficient to repress transcription by blocking initiation...approaches like zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required...which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the C-terminus of Cas9...edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces the unedited...uses a CRISPR-Cas9n fused to both a reverse-transcriptase and a serine integrase (Bxb1), along with two...initiation. More robust transcriptional repression (CRISPR interference, or CRISPRi) or activation (CRISPRa...target genes can be achieved by fusing dCas9 to transcriptional repressors or activators and targeting promoter...

...LTR after one round of reverse transcription, inhibiting transcription of the full-length virus after ...that lentiviruses most often integrate into transcriptionally active regions, regions recently involved ... into the 5' LTR after one round of reverse transcription. After incorporation into a host cell, this ...this deletion prevents further transcription of the full-length virus. The potential for oncogenesis is largely...necessary for activation of viral genomic RNA transcription. R is the repeat region. U3 in cis Unique 3’...necessary for activation of viral genomic RNA transcription. Removal of this region in the 3’ LTR in third-generation...LTR in cis Acts as an RNA pol II promoter; the transcript begins, by definition, at the beginning of R,...

...promoter Reverse pBluescript KS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC...promoter Reverse pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC... Sequencing Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth...TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors... Sequencing Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia...recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse DsRed1-C AGCTGGACATCACCTCCCACAACG...TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral...

...genome. Gamma-retroviral vectors tend to prefer transcription start sites, such as promoters and enhancers... into the 5' LTR after one round of reverse transcription. After incorporation into a host cell, this ...this deletion prevents further transcription of the full-length virus. The potential for oncogenesis is largely...Li, Y., Crise, B., & Burgess, S. M. (2003). Transcription start regions in the human genome are favored...necessary for activation of viral genomic RNA transcription. R is the repeat region. U3 in cis Unique 3’...necessary for activation of viral genomic RNA transcription. Removal of this region in the 3’ LTR creates...LTR in cis Acts as an RNA pol II promoter; the transcript begins at the beginning of R, has a 5' cap structure...

... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa...fused to transcriptional activators that need to be within a given range of the transcription start site...Prime editor (Cas9 nickase fused to reverse transcriptase (RT)) Can edit within a wider window than most...genome sequence dCas9 or dCas9 fusion with transcriptional repressor (such as dCas9-KRAB) dCas9-KRAB can...modifying the genome sequence dCas9 fusion with transcriptional activator (such as dCas9-VP64) Many different... interest, where the Cas9 protein can block transcription from ever initiating. gRNAs targeting regions...and gRNA. This method involves using in vitro transcription reactions to generate mature Cas mRNA and gRNA...

...synthetic two-part transcription factors, where Cry2 and CIB1 are fused to a transcriptional activation domain... Microbial Opsin Variants Opsin Type Variant Description Peak Response Spectra (nm) Channelrhodopsins:...protein activation, membrane localization, and transcriptional activation. In the widely used Cry2-CIB1 system... binding domain, allowing light to activate transcription. Phytochromes and light oxygen voltage (LOV)...Collection for your next experiment. For a full description of different domains used in these plasmids, ...Glossary of Optical Switches Category Variant Description Peak Response Spectra (nm) BLUF domains bPAC ...and its interacting partner CIB1 to control transcription effectors OPTOSTIM PHR domain2 of cryptochrome...

...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...MoClo kits in our collection. Kit name Type PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne... Sylvestre Marillonnet Plasmids to generate transcription units for protein secretion in yeasts S. cerevisiae...including overexpression plasmids with up to eight transcription units. Yarrowia lipolytica Golden Gate tool ...plasmids to assemble and integrate up to three transcription units in the oleaginous yeast Y. lipolytica ...

...Promoter Region Drives transcription of the insert. The promoter recruits transcriptional machinery and can...DNA is converted to RNA in a process called transcription. RNA uses the same nucleotide bases as DNA, ...General structure of a plasmid. Plasmid Element Description Origin of Replication ( ori ) DNA sequence which... prior to use in an experiment. Plasmid Type Description Addgene Resource(s) Cloning Plasmids Used to ...vectors must contain a promoter sequence, a transcription terminator sequence, and the inserted gene. ...largely on which promoter is used to initiate transcription. Empty Backbones Gene Knock-down Plasmids Used...the luciferase gene to determine the level of transcription driven by that promoter. Fluorescent Protein...

... length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs...and late (L1, L2, L3, L4, L5) regions. Early transcripts are expressed shortly after the virus enters ...replication and host cell manipulation. Late transcripts are expressed after DNA replication starts and...produced by replacing the early and late adenoviral transcript regions between the two ITRs with the transgenes...removing the E1 region, containing the E1A and E1B transcripts, and the E3 region from the viral genome. This...plasmid E2A, E2B, E3, E4 in trans Adenoviral early transcript regions involved in viral DNA replication and.... L1, L2, L3, L4, L5 in trans Adenoviral late transcript regions that encode for structural capsid proteins...

...bidirectional control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD...their effect, and outcome in neurons. Table 2: Descriptions of PSAMs and their activity in neurons PSAM ...Image courtesy of Ute Hochgeschwender . Table 3: Descriptions of LMOs and their activity in neurons LMO Luciferase...