We narrowed to 455 results for: abo.5

...a lab is nothing like a typical part-time or 9-to-5 job. I had to ask to find out what a “postdoc” is,...dig deep Talk to your professors about their research, and learn about what makes them excited to do what...sciences), people conduct research to answer questions about how the world works. As scientists, we probe beyond...curious person. I like to ask questions and think about the best way to answer those questions. I’ve met...enjoy, is worthwhile and can help us make decisions about what we want to do in the future. How do I get started...sense of what kind of research you would be excited about. I know quite a few friends who opted to join labs... a lot out there worth exploring! Being excited about the science allows you to ask more interesting questions...

...piggyBac, which is a big advantage over viral vectors (~5 kB payload for AAV and ~8 kB payload for lentivirus...Addgene blog Learn about the INTEGRATE system for bacterial genome engineering  Read about the Sleeping Beauty...DNA transposons are most commonly used in the laboratory for genome manipulation. When transposons are...Applications of transposons Now that you’ve learned about some of the popular transposon systems, let’s take...2020) Jump around: transposons in and out of the laboratory. F1000Res 9:135. https://doi.org/10.12688/f1000research...Beauty DNA transposon Learn about the piggyBac DNA transposon ...

...1087–1093 . https://doi.org/10.1038/s41592-019-0614-5 Sztal TE, Stainier DYR (2020) Transcriptional adaptation... “transitivity,” calls into question any claims about specificity of a given RNAi technique. While transitivity...conceptually similar to the microRNA precursor mentioned above and is a popular RNAi trigger in the mammalian research...substantial ways: variable silencing efficiency and labor-intensive processes to isolate RNAi plants. With...resource on the Addgene blog Browse our blog posts about plant biology Check out our CRISPR blog posts Resources...

...cells. Allow sample(s) to sit at room temperature for 5 minutes to allow for dissociation of the nucleoprotein...Ethanol and vortex for a few seconds. Centrifuge for 5 minutes at 10,000 x g at 4 °C and remove the supernatant...without disturbing the pellet. Air-dry the pellet for 5-10 minutes. Critical It is important to not let the... working with the volatile reagents in the list above. Procedure Option #1 - Solution D Protocol Before...

...rAAVs, which can only package sequences shorter than 5 kb (Hirsch et al., 2016; Hudry and Vandenberghe, 2019...FLEx enters the scene. FLEx: A light when night is about you! The FLEx (for flip-excision) switch (aka DIO...PMC4166436. Resources on the Addgene blog Learn more about FLEx vectors Download our Plasmids 101 eBook Read...

...autoimmunity and inflammation. Nature Reviews Immunology, 10(5), 301–316. https://doi.org/10.1038/nri2761 Chiu, M...structure-guided directed evolution. The nice thing about these methods is that they all follow the same general...performance. If you are interested in learning more about antibody engineering technologies, the Institute...

...), 1–20. https://doi.org/10.1038/s41467-021-24759-5 Zhang, K., & Cui, B. (2015). Optogenetic control of...which tools to use, and what do you need to know about them to be successful in your experiments? In this...

...resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice between each pulse,...resuspend the pellets in a total of 5 mL of cell lysis buffer (recipe above). Pipet back and forth to resuspend.... T-175 flask, Corning 430825, 175 cm 2 Cellstack 5, Corning 3319, 3180 cm 2 Cellstack 2, Corning 3269...high glucose, add 55 mL of heat-inactivated FBS and 5 mL of glutaGRO 11 mL of 200 mM L-alanyl-L-glutamine... water + 100 mL of 1 M Tris HCl pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride....8-fold. See the recipe for D1 + 0.1 M sorbitol above. Carefully pour off the media into a waste container...pellets and keep on ice. Process the cell pellet from above as follows: Resuspend and lyse the cells by adding...

...PMID: 25998715. PubMed Central PMCID: PMC4491443. 5. Scott, Andrew M., Jedd D. Wolchok, and Lloyd J. Old...potential beneficiaries. Collaborative therapy For the most efficient outcomes, collaborative therapies must be... of the tolerance-producing antigens enunciated above. Finally, signals released from the microenvironment...are in their clinical trial phase. In all of the above therapeutics, techniques like genome engineering...are beginning to see the fruits of many years of labor with up and coming immunotherapy treatments. As ...clinic, physicians and researchers are learning much about how treatment regimens can be improved and how the...ahead of the disease in patients and developing collaborative treatments will go a long way in combating this...

...PloS one 4.10 (2009): e7338. PubMed PMID: 19823671. 5. Griffin, B. Albert, Stephen R. Adams, and Roger Y...environment? If these are pressing issues in your laboratory, then FRET experiments are a viable biophysical...to consider these cases separately when talking about the tools that are available. Let’s consider the...that, if you make an FP fusion, you are inserting about 20-25 kDa of protein mass into your protein and ...together The FRET donors and acceptors described above can be paired together to measure a wide range of...of your protein that can lead to novel insights about its biology and its behavior. See the table below...

...PMID: 21596592. PubMed Central PMCID: PMC3164316. 5. Chieppa, Marcello, et al. "Dynamic imaging of dendritic...fluorescence microscope where the light source is mounted above (epi) the specimen and the excitation light passes...technique that allows imaging of living tissue up to about one millimeter in depth. Two low-energy photons ...response, but the study of these dynamics was still laborious as epifluorescence microscopy wasn’t able to give...skin. Two-photon intravital microscopy. The video above depicts the infiltration of neutrophils expressing...

...nanotoxicological studies. Environmental Science: Nano, 6(5), 1516–1526. https://doi.org/10.1039/c8en01381k  Sridharan... A., Purkayastha, N., Flad, K., Schmidt, M. F., Tabor, A., Gmeiner, P., Hübner, H., & Weikert, D. (2020...

...can be created via PCR with primers that contain a 5′ end that is identical to an adjacent segment and ...single-strand DNA 3’ overhangs by chewing back from the DNA 5’ end. Complementary DNA fragments can subsequently... to several hundred kilobases. Nature Methods , 6(5), 343–345. https://doi.org/10.1038/nmeth.1318 (Link... the right). When designing your plasmid, think about what DNA segments you will need to join to create...

... CRMAGE is an incredibly fast protocol, with only 5 hours incubation time needed for a single round of...CRISPR Featured Topic Page Learn more about Cpf1 Find out about CRISPR Multiplexing Resources on Addgene.org...coli and other bacterial species. Read on to learn about the tools available for bacteria and some of the...that can be used in this way. As described in the above CRISPRi section, the Marraffini Lab published a ...as a collection of organisms, their genes, and metabolic processes, occupying the gut. Many human diseases...

...the wells. Immediately before use, mix 5 mL TMB Solution and 5 mL Peroxide Solution from the TMB substrate...at room temperature or overnight at 4 °C . Section 5: TMB reaction Carefully remove the plate seal from...point. If your unknown sample’s absorbance falls above the range of the standard curve you will need to...

...over a broad dynamic range that typically spans 2–5 orders of magnitude, which includes a wide dynamic...If you’ve ever run a western blot, or thought about running one, you’ll know there’s a lot of choices...

...DMEM complete + 10 µg/mL polybrene (µL) 0 0 500 1:5 300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500...well gets one dilution, so a 6-well plate will hold 5 dilutions plus one 'no virus' control well). Perform...cells in the untransduced well (0 µL lentivirus, above) are dying. Perform regular media changes and monitor...

...confirm. Addgene's plasmid information pages recommend 5’ and 3’ sequencing primers. These primers typically...Addgene lists the primers used to obtain each result above the posted sequence in the "View Sequence" link....sequence than expected and wish to contact Addgene about the accuracy of your plasmid, please email help@...

...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...stem cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...3' end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse L4440 AGCGAGTCAGTGAGCGAG 5' of MCS in L4440 vector Forward...LacI-R GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ Reverse LexA... pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward...GTTGCCTTTACTTCTAGGCCT 5' of EcoRI site in pcDL vector Forward pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in ...

... µL, 10 µL) Bacti Cell Spreaders (VWR, 60828-680) 5 mL and 10 mL Serological pipettes Ice slurry (Ice ... mL Vented Falcon Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate...require modifications dictated by the originating laboratory for optimal results. If you obtained the pooled...