We narrowed to 658 results for: EPO;

1. Antibodies 101: Choosing the Right Isotype

   Type

   Blog Post

   ... reactive ones. And make sure to check for any reported cross-reactivity when planning your experiment...

2. 5 Tips for Troubleshooting Viral Transductions

   Type

   Blog Post

   ... and the type of virus, there have been varied reports of titer losses from 5% to 50% per freeze thaw ...

3. Plasmids 101: Terminators and PolyA signals

   Type

   Blog Post

   ...characterized a set of prokaryotic terminators and deposited several with Addgene (1). Prokaryotic polyadenylation...

4. The Materials Science of Optogenetics Experiments

   Type

   Blog Post

   ...wirelessly-controlled optogenetic implants have been reported by several groups [4, 5, 6]. These have the obvious...

5. How-to: 5 Steps to a Great Panel Discussion

   Type

   Blog Post

   ...published on LinkedIn. Follow Addgene on LinkedIn for repository news and updates. Panel discussions are becoming...

6. Story of a SynBio Startup: RevBio's Epiphany (or Lack Thereof)

   Type

   Blog Post

   ... a pizza joint. Silly ideas (mining local salt deposits to sell at farmers markets), and serious ideas...

7. Validated gRNA Sequences

   Type

   Collection

   ...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...possible on the sequences, and email the file to deposit@addgene.org with the subject heading "gRNA sequence...

8. No Llamas Required - Synthetic Nanobodies Against Membrane Proteins

   Type

   Blog Post

   ... Signaling and Protein Purification RANbodies: Reporter Nanobody Fusions Plasmids 101: Secondary Nanobody...

9. Chromoproteins: Colorful Proteins For Molecular Biology Experiments

   Type

   Blog Post

   ...improved expression in living cells. Scientific Reports, 9(1). https://doi.org/10.1038/s41598-019-48604...

10. Tips to Make the Most of a Scientific Conference

    Type

    Blog Post

    ...Addgene website Become of a member of the Addgene depositor community ...

11. Mobile-CRISPRi: Bringing CRISPRi to Diverse Bacteria

    Type

    Blog Post

    ...measured by knockdown of a constitutely expressed RFP reporter, was variable across bacterial strains, ranging...

12. CrispyCrunch: High-throughput Design and Analysis of CRISPR+HDR Experiments

    Type

    Blog Post

    ...analysis because of its ease-of-use and comprehensive reports. With CrispyCrunch, you get the all information...

13. Plasmids 101: 5 factors to help you choose the right cloning method

    Type

    Blog Post

    ...works best for you. Happy cloning (and be sure to deposit your finished constructs at Addgene!). References...

14. The Scientific Conference Poster Session: Tips for Success

    Type

    Blog Post

    ...Addgene website Become of a member of the Addgene depositor community Learn about careers at Addgene ...

15. Production of Virus in Insect Versus Mammalian Cells

    Type

    Blog Post

    ...producing virus within 24 to 48 hours. Harvesting timepoints will depend on your specific virus, so this is...

16. Viral Vectors 101: Producing Your rAAV

    Type

    Blog Post

    ...different titers are measured. A TCID50 measurement reports an infectious titer, meaning the concentration ...

17. Addgene's Cancer Collection Pages Connect the Research Community

    Type

    Blog Post

    ...Addgene.org Visit our Cancer Collection Pages Deposit Your Plasmids for Studying Cancer Browse Our Other...

18. Google Forums Round Up: First Impressions of NgAgo

    Type

    Blog Post

    ...Researchers from a variety of institutions recently reported their inability to recapitulate the results of...

19. Plasmids 101: Optimizing Plasmid Yields

    Type

    Blog Post

    ...manufacturer. On Addgene plasmid pages, you may see depositor recommendations to grow a plasmid at 30℃ or room...

20. Zinc Finger Consortium Reagents

    Type

    Collection

    ...engineering and expressing zinc finger proteins deposited by Zinc Finger Consortium members like the Joung...Consortium members Keith Joung and Daniel Voytas have deposited at Addgene various reagents for engineering and...