... reactive ones. And make sure to check for any reported cross-reactivity when planning your experiment...

... to start is the 24-piece lac operon assembly deposited by NEB – and don’t forget to ask DAD for some ...

...selection of guideRNAs. Of particular note, ABE8s reported in this work did not cause genome-wide, guide-...

... and the type of virus, there have been varied reports of titer losses from 5% to 50% per freeze thaw ...

...characterized a set of prokaryotic terminators and deposited several with Addgene (1). Prokaryotic polyadenylation...

...wirelessly-controlled optogenetic implants have been reported by several groups [4, 5, 6]. These have the obvious...

...published on LinkedIn. Follow Addgene on LinkedIn for repository news and updates. Panel discussions are becoming...

... a pizza joint. Silly ideas (mining local salt deposits to sell at farmers markets), and serious ideas...

...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...possible on the sequences, and email the file to deposit@addgene.org with the subject heading "gRNA sequence...

...works best for you. Happy cloning (and be sure to deposit your finished constructs at Addgene!). References...

...Addgene website Become of a member of the Addgene depositor community Learn about careers at Addgene ...

...Addgene website Become of a member of the Addgene depositor community ...

...measured by knockdown of a constitutely expressed RFP reporter, was variable across bacterial strains, ranging...

...analysis because of its ease-of-use and comprehensive reports. With CrispyCrunch, you get the all information...

...producing virus within 24 to 48 hours. Harvesting timepoints will depend on your specific virus, so this is...

...different titers are measured. A TCID50 measurement reports an infectious titer, meaning the concentration ...

... Signaling and Protein Purification RANbodies: Reporter Nanobody Fusions Plasmids 101: Secondary Nanobody...

...improved expression in living cells. Scientific Reports, 9(1). https://doi.org/10.1038/s41598-019-48604...

...Addgene.org Visit our Cancer Collection Pages Deposit Your Plasmids for Studying Cancer Browse Our Other...

...Researchers from a variety of institutions recently reported their inability to recapitulate the results of...