We narrowed to 1,082 results for: TOR

...impacts in the way we study and treat complex or multifactorial diseases, enabling faster diagnosis and treatment...

...usual. In the presence of a specific protease inhibitor, asunaprevir, the viral protease can no longer...

...) For CrispyCrunch, we wanted to consider both factors, as a bench scientist would looking at a genome...

...RNA delivery does however rely on cloning into a vector or in vitro synthesis, which could be less desirable...

...to RNA deaminase ADAR2 to create a specific RNA editor. Cas13 enzymes are advantageous because they do...

...industry, nonprofit organization, law office, journal editor, etc.--so everyone’s experience will be a little...

... and exciting to listen to the many individual stories and get (sometimes refreshing) insights into how...

.... The pDonor plasmid pRE57-Ter with multiple terminators can serve to interrupt genes (or gene clusters...

...acoustic reporter genes for real-time in vivo monitoring of tumors and tumor-homing bacteria. Nat Biotechnol...

...given therapeutic approach brings to patients, doctors, and insurance providers, and is crucial to how...

...clone the PCR products into a pBluescript cloning vector and sequence the resulting plasmid. It can take...

...performing a single base pair edit with a prime editor. What next? When generating a knock-in mutation...

...currently a research scientist in the Department of Laboratory Medicine at the University of Washington. She...

...loop Bunsen burner (or other small flame source) Incubator Marker Reagents LB agar plate (with appropriate...resistance and your initials. Labeling within a laboratory setting is important for organization, and it...

...spreading of antibiotic makes it easy for an investigator to conveniently plate and select transformed...spreading Bunsen burner (or other small flame source) Incubator Reagents 6 cm diameter LB/agar plates without ...

... lab! Introduction A water bath is a piece of laboratory equipment that helps bring your materials to .... Water baths can also be placed in walk-in refrigerators to achieve a temperature between 4°C and room...

...to drive cell type-specific delivery of a viral vector (Strebinger et al., 2023). All this flexibility...

...a blank chart to your spreadsheet. In the Chart Editor , select the Chart Type drop down menu and select...calculate this for you as follows: In the Chart Editor , select the Customize tab. Select the Series drop...

...microcentrifuge tube. Use the lysate immediately or store at -80 °C until ready to use. Section 2: Determine...the Top Stack to one side and discard the white separator. Keep the Bottom Stack in the plastic tray. Place...

...19246619.Downey N. Interpreting melt curves: An indicator, not a diagnosis. IDT, 2014. Dwight Z; Palais ...

... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...

...important for your experiments. There are a number of factors to consider when selecting sequencing primers, ...

... reagents for a stock mixture is an essential laboratory technique, as imprecise measurements can affect...

...especially useful for introducing promoters, terminators, and other short sequences into the assembly ...

... After all of the sample is unloaded, push the pipettor to the second stop and carefully raise the pipette...

...curve or dilute the unknown sample (don’t forget to factor in that dilution when calculating the original ...

...Viral Vectors Adenoviral Vector Guide Adenoviral Vector Guide Jump To: Adenoviral Vectors Vector Production...First-generation rAdV vectors. Second-generation rAdV vectors Second-generation rAdV vectors contain the genomic...third-generation rAdV vectors. Figure 3: Second-generation rAdV vectors. Third-generation rAdV vectors Third-generation...Read our adenoviral vector guide to learn about adenoviral vector components, production and common uses...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...adenoviral (rAdV) vectors in order to deliver genetic cargo into cells. Most rAdV vectors are based on adenovirus...Generations First-generation rAdV vectors The first generation of rAdV vectors was developed by removing the...

...Viral Vectors AAV Vector Guide Adeno-Associated Viral (AAV) Vector Guide Jump To: AAV Vectors Vector Production...vitro factories for the new viral particles in the laboratory. The cell line used for rAAV vector production...Read our adeno-associated viral vector guide to learn about AAV vector components, production and common...used as viral vectors for gene therapy applications. This guide contains many viral vector-specific terms...adenovirus, read our Adenoviral Vector Guide . Recombinant AAV Vectors Wild-type AAVs have been modified...Figure 2: Plasmids required for rAAV vector production. AAV Vector Production Cloning Cloning your transgene...protocols, see Addgene’s Viral Vector Protocols . Figure 3: Overview of rAAV vector production. Genome Integration...

...Chemogenetic Receptors: RASSLs The first chemogenetic receptors were based on G-protein coupled receptors (GPCRs...References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ion channels targeted...Specifically, Receptors Activated Solely by Synthetic Ligands (RASSLs) based on κ-opiod receptors (Coward et...intracellular calcium stores. There are currently three Gq DREADDs based on human muscarinic receptors: hM1Dq, hM3Dq...muscarinic receptors, hM2Di and hM4Di, and a Gi DREADD based on the human κ-opoid receptor, termed KORD...turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This DREADD was shown to have...DREADDs and their activity in neurons DREADD Receptor Effector Ligand* Effect Outcome Reference Rq(R165L)...

...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward Amp-R ...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

...of base editors were cytosine base editors (pyrimidine-to-pyrimidine) and adenine base editors (purine-to-purine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in...

...array vectors and destination vectors designed for use with the Golden Gate TALEN and TAL Effector Kit ...assembled into a Level 2 vector, forming a functional genetic circuit. Level 2 vectors are often designed with... CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in...host range vectors compatible with the CIDAR MoClo cloning standard, including a combinatorial library of...Alistair McCormick Kit containing 96 parts and acceptor vectors for generating multi-part assemblies in either... and then combined by Gibson Assembly into acceptor vectors. The Mammalian Toolkit Mammalian Expression...MoClo system consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive...

...about viral vectors and their production, see our viral vector guides . Lentiviral vectors Lentiviral ...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral...Base editor (dCas9 or Cas9 nickase fusions with different base editing proteins) Many base editors fused...fusion with transcriptional activator (such as dCas9-VP64) Many different activator systems exist, including...base editors exert their functions within a limited window from the PAM sequence, and base editor variants...CRISPR protocols from Addgene depositors ). Browse empty gRNA expression vectors . Select Your Expression ... CRISPR plasmids . Delivery Using Viral Vectors Viral vectors are a great option, as they offer high expression...

...the RNA polymerase and transcription factors. Transcription factors are proteins which recruit RNA polymerase...by various DNA regulatory sequences, including enhancers, boundary elements, insulators, and silencers...sigma factors that assist the RNA polymerase in binding to the promoter region. Each sigma factor recognizes... RNA polymerase), an operator (a segment of DNA in which a repressor or activator can bind), and the structural...several transcription factors, and other accessory proteins (such as activators and structural proteins...also contains transcription factor binding sites, but mostly contains regulatory elements. Common Eukaryotic... Promoters are a vital component of expression vectors because they control the binding of the RNA polymerase...

...an endogenous GPCR, such as adrenergic receptor, makes a receptor that activates the native signaling cascade...experiments. UV Receptors Name Description Peak excitation λ (nm) UVR8 Plant photoreceptor protein that ...Depending on your answer, you'd pick an excitatory or inhibitory opsin, respectively. For experiments targeting... channels known as opsins (including chimeric receptors such as OptoXRs) or optical switches. Naturally-occuring...type. OptoXRs are chimeras of a G-protein coupled receptor (GPCR) and an opsin engineered to activate a specific...in excitation (depolarization) of the neuron. Inhibitory (hyperpolarizing) ChR variants Anion-conducting...channelrhodopsins are versatile and robust optogenetic inhibitors that act by hyperpolarizing cells via high K ...

...studying regulatory sequences, screening certain types of proteins (such as cell surface receptors or transcription...enzyme fused to a transcriptional activator to target genes or regulatory regions, where it stimulates transcription... must first be used to make viral vectors . This pooled viral vector library is subsequently used to deliver...) and packaged into lentiviral vectors (if delivering by viral vectors). The screens diverge at a few ...transcription factors), or observing the effects of mutagenesis of a single gene. As you might have guessed...phenotypes. These libraries are also commonly used to monitor the dynamics of heterogeneous tumors. Advantages...transcription by recruiting activators or modifying local chromatin. Inhibition : CRISPR inhibition libraries...

...antibodies can be stored at 4 °C for short-term storage. For long-term storage they should be stored at -20 °C... Antibody Handling Storage Check the manufacturer’s instructions for exact storage requirements. As a ...tips for storing your antibody: Antibodies conjugated to fluorophores should never be stored below 4 °... antibodies should not be stored in sodium azide, as it acts as an inhibitor to HRP. In those cases, thimerosal...define key terms, summarize antibody production and storage techniques, and explain common applications. Science...expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell, and sample... a primary antibody, which becomes the limiting factor for the number of proteins you can detect in a ...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...study. Expression vectors must contain a promoter sequence, a transcription terminator sequence, and the...DLYDDDDK Thrombin LVPRGS BAD (Biotin Acceptor Domain) GLNDIFEAQKIEWHE Factor Xa IEGR or IDGR VSVG YTDIEMNRLGK...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...can be replicated easily and efficiently in a laboratory setting. Are stable — Plasmids are stable long-term...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...

...entry vector containing your DNA of interest (or obtained one of the thousands of entry vectors deposited...shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase enzymes...a simple and efficient cloning method, Gateway vectors and recombination enzymes can be quite expensive...donor , Gateway entry , and Gateway destination vectors with different promoters, tags, selection markers...comes from a pre-cut, linear, cloning-ready TOPO vector that has a DNA topoisomerase I covalently bound...-ready, and it is not feasible to create a TOPO vector yourself. Additionally, the efficiency can vary...overhangs of 10–12 base pairs on the 5' end of both the vector and insert. These overhangs can easily anneal, ...

...viral vectors contains an introduction to each vector and its applications, tips for using vectors in your...Overlay Select Viral Vectors 101 July 2024 | Second Edition About Viral Vectors 101 July 2024 | ...protein; information on FRET, biosensors, and monitoring protein localization; an introduction to non-...the many career options in science, advice on mentoring and management, resources for identifying your...