We narrowed to 64 results for: 129
-
TypeCollection...Bassoon Rat Mouse 182079 pan-Synapsin scFv [L125/129] L125/129 pan-Synapsin Mouse 182080 Aldh1L1 scFv [N103...Ppp1r9a [L129/93R] Neurabin-1/Ppp1r9a Mouse Mouse IgG2a 211583 Anti-Neurabin-1/Ppp1r9a [L129/96R] Neurabin...N289/16 scFv SUR1 Rat Mouse 206736 Mad3 scFv [N129/15] N129/15 scFv Mad3 Human Mouse 206737 GluN2C/NR2C ....2 K+ channel Rat Mouse IgG2a 140075 Anti-Mad3 [N129A/6R] Mad3 Human Mouse IgG2a 140076 Anti-Arl13b [N295B...Human Mouse IgG2a 177472 Anti-Pan-Synapsin [L125/129R] Pan-Synapsin Mouse IgG2a 177473 Anti-SAPAP3 [L126...Thorase/Atad1 Mouse Mouse IgG2a 177498 Anti-Mad3 [N129/15R] Mad3 Human Mouse IgG2a 177499 Anti-HCN3 [N141...Calretinin Human Mouse IgG2a 220391 Neurabin-1/Ppp1r9a [L129/57R] Neurabin-1/Ppp1r9a Mouse Mouse IgG2a 220392...
-
Immunology Research Plasmids and Resources
TypeCollection...CKR-L1, CKRL1, CMKBR8, CMKBRL2, CY6, GPR-CY6, MGC129966, MGC129973, TER1 CCR9 chemokine (C-C motif) receptor...FIL1(EPSILON), FIL1E, IL-1F6, IL1(EPSILON), MGC129552, MGC129553 IL1F7 interleukin 1 family, member 7 (zeta...necrosis factor (ligand) superfamily, member 15 MGC129934, MGC129935, TL1, TL1A, VEGI, VEGI192A TNFSF18 tumor...MNGIE, PDECGF, TP, hPD-ECGF UCN urocortin MGC129974, MGC129975, UI, UROC UCN2 urocortin 2 SRP, UCN-II, ...FIL1(EPSILON), FIL1E, IL-1F6, IL1(EPSILON), MGC129552, MGC129553, IL36A IL1F7 interleukin 1 family, member... PFP PRKCA protein kinase C, alpha AAG6, MGC129900, MGC129901, PKC-alpha, PKCA, PRKACA PRKCB protein kinase... -
Neurodegeneration Plasmid Collection
TypeCollection...leukoencephalopathy Pavel Krejci 202592 pGEX4T1-TEV-HsFbxo7-129-398/Skp1 FBXO8 GST, TEV tac Parkinson's Brenda Schulman...Lashuel 36048 pT7-7 asyn S129A SNCA T7 Parkinson's Hilal Lashuel 36049 pT7-7 asyn S129G SNCA T7 Parkinson's...Lashuel 36061 pT7-7 asyn S129I SNCA T7 Parkinson's Hilal Lashuel 36062 pT7-7 asyn S129L SNCA T7 Parkinson's... pT7-7 asyn S87A/S129A SNCA T7 Parkinson's Hilal Lashuel 36064 pT7-7 asyn S87E/S129E SNCA T7 Parkinson's...36065 pT7-7 asyn S87A/S129E SNCA T7 Parkinson's Hilal Lashuel 36066 pAAV asyn S129A SNCA CMV Parkinson's...Aebischer 36067 pAAV asyn S129G SNCA CMV Parkinson's Hilal Lashuel 36068 pAAV asyn S129E SNCA CMV Parkinson'...36069 pAAV asyn S129D SNCA CMV Parkinson's Patrick Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's... -
The Pleiades Promoter Project
TypeCollection...EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS Ple66...pEMS1185 EGFP/NLS Ple125 LCT pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602... intron-lacZ/NLS Positive Control CAG promoter pEMS1293 cre N/A CAG promoter pEMS1164 EGFP/cre N/A CAG...CAG promoter pEMS1277 EGFP/NLS N/A CAG promoter pEMS1294 intron-lacZ/NLS N/A CAG promoter pEMS1488 intron-lacZ... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol... screen . Moffat J et. al. Cell . 2006. 124:1283-1298. PubMed . In vivo gene delivery and stable transduction... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TCGTCCAATAGCTTCTcagtcacgcacgcctgTGAGTTTCTGCTCTTTA gria3a TALEN1295 & TALEN1260 TCGTCCAATAGCTTCTCagtcacgcacgcctgtGAGTTTCTGCTCTTTA...TGACAGCGTTTACTCCACtagaagaagctgtgcgGGAGGATTTCTTTTTATA hey2 TALEN1297 & TALEN1257 TCTTCCGTTTCCACATCCaccacatcccaacagagcAGCGGGAGCAGCAGTAAA...TCTCTAGGTGGACCATTTccctcaacagctcaccGATGCCATCACAAGCCCA nphs2 TAL3126 & TAL3129 TTCACACAGAACCATACTgaaatcggtaagaaaaGGATGACCACTGACAGGA... -
Luciferase Plasmid Collection
TypeCollection...the cytoplasm of mammalian cells Peter Cockerill 212936 pGL3 Basic Vector Firefly Vector for investigating...promoter/enhancer regions. Lentiviral Nadav Ahituv 212935 pGL4.84(hRlucCP/Puro) RapidResponse™ Renilla Vector...investigating regions controlling transcription Pete Stecha 212933 pGL4.82(hRluc/Puro) Renilla Vector for investigating... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...224016 pAAV-AiE0459m_3xC2-minBG-SYFP2-WPRE3-BGHpA AiP12918 AiE0459m_3xC2 SYFP2 Layer 5_ET Isocortex 229920...Isocortex 224017 pAAV-AiE0667m-minBG-SYFP2-WPRE3-BGHpA AiP12944 AiE0667m SYFP2 Layer 5_ET_Chrna6 Isocortex 214540... 230473* pAAV-AiE0354h-minBG-iCre(R297T)-BGHpA AiP14129 AiE0354h Cre Vip interneurons Isocortex 191727... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...Control for endomembrane (CaaX box) localization 101129 pSNAPf-Cox8A Control Plasmid SNAP-tag Control for...condensation domain. J Biol Chem. 273(35):22773-81. PMID:9712910 Vivero-Pol L, George N, Krumm H, Johnsson K, Johnsson... -
CRISPR Pooled gRNA Libraries
TypeCollection...14,671 Pan-cancer CasRx lncRNA Albarossa Library 212966 Knockout Human Rad 3rd Varies 156,250 Mouse CRISPR...630 Mouse CRISPR Metabolic Gene Knockout Library 160129 Knockout Mouse Birsoy 3rd 8 22,909 Mouse Liver ... -
Arf GTPase Family
TypeCollection...Mammalian (pcDNA3) GAP Asap1 (PAG2, PAP, CENTB4) 5080 1129 GAP Asap2 (PAG3, CENTB3, AMAP2) 8853 1006 GAP Asap3... -
CRISPR Plasmids - Plants
TypeCollection...pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31 rice snoRNA U3 BsaI none S. pyogenes Yang... -
Control AAV Preps
TypeCollection...hSyn EYFP Cre and Flp dependent 8, rg* Deisseroth 137129 pAAV-Ef1a-Con/Fon-BFP EF1a BFP Cre and Flp dependent... -
Lentivirus Plasmids
TypeCollection...destination plasmid for cDNA expression Ramalho-Santos 24129 pULTRA 3rd bi-cistronic expression of EGFP and the... -
CRISPR History and Development for Genome Engineering
TypeCollection...systems. Nat Rev Microbiol . 13(11):722-36. PMID: 26411297 Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... Golgi apparatus Giantin mScarlet Dorus Gadella 129630 mTurquoise2-Giantin Golgi apparatus Giantin mTurquoise2... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Chemistry & Biology, October 2013, Vol. 20 No. 10, pp.1296-304 Kogure et al. : Nature Biotechnology, May 2006... -
Validated gRNA Sequences
TypeCollection...25619936 Sato ASCL1 H. sapiens TGGGGCTGGGTGTCCCATTGAAA 64129 activate S. pyogenes 25619936 Sato ASCL1 H. sapiens... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI none S. pyogenes Yang pRPR1_gRNA_handle_RPR1t... -
Fluorescent Protein Guide: Biosensors
TypeCollection...bacterial cell division. Science. 2010 Jun 4;328(5983):1295-7. Samuel Miller Chloride (Cl-) ClopHensor biosensor...