Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 151 results for: 199

Showing: 41 - 60 of 151 results

  1. The MTA at Addgene

    Type
    Blog Post
    ...time-consuming and lengthy. So the NIH called a meeting in 1990 to discuss the process, which eventually led to ...agreement on the transfer of biological materials in 1995: the UBMTA. Because biological materials are widely...

  2. Summer SciComm Series: A PhD in Science Communication

    Type
    Blog Post
    ...minds perform to avoid cognitive dissonance (Kunda, 1990). More specifically, they were engaging in a behaviour...10), 732-735. doi:10.1038/nclimate1547 Kunda, Z. (1990). The case for motivated reasoning. Psychological...

  3. Antibodies 101: Monoclonal Antibodies

    Type
    Blog Post
    ...Committee on Methods of Producing Monoclonal Antibodies, 1999). This creates an immortal cell population that ... Washington (DC): National Academies Press (US); 1999. 1, Generation of Hybridomas: Permanent Cell Lines...

  4. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato ...pyogenes 25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato ... pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS...pyogenes 25619936 Sato IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato IL1RN...pyogenes 25619936 Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted...pyogenes 25619936 Sato MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato ...pyogenes 25619936 Sato MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato ...

  5. To Each HIS Own

    Type
    Blog Post
    ... elute proteins with up to 95% purity (Janknecht 1991, Hochuli 1988). In this purification approach, the...recombinant vaccinia virus. Proc Natl Acad Sci U S A. 1991;88(20):8972-6. Moks T, Abrahrnsen L, Oesterlof B, ...

  6. Gendered Innovations: Why Does Sex of the Cell Matter?

    Type
    Blog Post
    ...According to the US General Accounting Office, between 1997 and 2000, ten drugs were withdrawn from the US market...ten drugs were withdrawn from the market between 1997 and 2000. There are many reasons why drugs fail ...

  7. Plasmids 101: Golden Gate Cloning

    Type
    Blog Post
    ...Type IIS restriction enzymes, first discovered in 1996. Type IIS restriction enzymes are unique from "traditional...Skowron PM, Rutkowska SM, Hong SS, Kim SC. Genet Anal.1996 Dec;13(6):139-45. PubMed. A one pot, one step, precision...

  8. Plasmids 101: Cre-lox

    Type
    Blog Post
    ...transgenic mice. Orban, P.C., Chui, D., and Marth, J.D. 1992. PubMed PMID: 1495975. PubMed Central PMCID: PMC49604...gene targeting. Gu, H., Zou, Y.R., and Rajewsky, K. 1993. PubMed PMID: 8513499. Resources on Addgene.org ...

  10. Viral Vectors 101: Chemogenetics

    Type
    Blog Post
    ...responses as decreased heart rate (Redfern et al., 1999) or altered neuron excitability (Zhu et al., 2014...Hennighausen L, Bujard H, Fishman GI, Conklin BR (1999) Conditional expression and signaling of a specifically...

  11. Plasmids 101: Terminators and PolyA signals

    Type
    Blog Post
    ... vitro analyses. Molecular and Cellular Biology. 1992. PMID: 1333042. PubMed Central PMCID: PMC360476....Delivered by Retroviral Vectors. Journal of Virology. 1999. PubMed PMID: 10074136. PubMed Central PMCID: PMC104046...

  12. Viral Vectors 101: Producing Your rAAV

    Type
    Blog Post
    ...enzyme-linked immunosorbent assay (ELISA) (Grimm et al., 1999), quantitative PCR (qPCR) (Aurnhammer et al., 2012..., Ferrari, F., Samulski, R., & Kleinschmidt, J. (1999). Titration of AAV-2 particles via a novel capsid...

  14. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ... – 39.
 A. H. Voie, D. H. Burns, F. A. Spelman. (1993)  J. Microsc. 170, 229 – 236.
 Pubmed. P.A Santi....-U. Dodt. (2012). Nature Protocols, 7(11), 1983–1995. Pubmed. K. Chung, J. Wallace, S.Y. Kim, S. Kalyanasundaram...

  15. Antibodies 101: Producing Recombinant Antibodies

    Type
    Blog Post
    ...sure to set the absorbance to 280 nm (Pace et al., 1995). You’ll also need to know the extinction coefficient...absorption coefficient of a protein. Protein Sci. 1995 Nov;4(11):2411-23. doi: 10.1002/pro.5560041120. ...

  17. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...fluorescence. The protein structure, first reported in 1996, is an eleven β-sheet-containing “barrel” shape,...improve its physical and biochemical properties. In 1995, Roger Y. Tsien described an S65T point mutation...

  18. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Mouse IgG2a 199396 Anti-Nav1.2 Na+ channel [K69/33R] Nav1.2 Na+ channel Rat Mouse IgG2a 199397 Anti-Gephyrin...IgG2a 199398 Anti-Gamma-protocadherin-A3 [N144/17R] Gamma-protocadherin-A3 Rat Mouse IgG2a 199399 Anti-...Mouse IgG2a 199400 Anti-Kv1.7 K+ channel [N471/27R] Kv1.7 K+ channel Rat Mouse IgG2a 199401 Anti-VAPA [...Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404 Anti-Kv2.1...Rat Mouse IgG2b 199407 Anti-Ankyrin-G [N106/36R-2b] Ankyrin-G Human Mouse IgG2b 199408 Anti-Kir2.1 K+ ...channel Rat Mouse IgG2b 199409 Anti-RGS14 [N133/21R-2b] RGS14 Rat Mouse IgG2b 199410 Anti-GFAP [N206A/8R-... IgG2b 199412 Anti-Cav1.2 Ca2+ channel [N263/31R-2b] Cav1.2 Ca2+ channel Rat Mouse IgG2b 199413 Anti-Arl13b...

  19. Plasmids 101: Codon usage bias

    Type
    Blog Post
    ...in highly expressed genes (Emilsson and Kurland, 1990). Controlling gene expression through gene sequence...abundance in Escherichia coli." The EMBO journal 9.13 (1990): 4359-4366. PubMed PMID: 2265611. PubMed Central...

  20. Plasmids 101: Gateway Cloning

    Type
    Blog Post
    ...experimental needs. Since its invention in the late 1990s, Gateway cloning technology has become very popular...Unit 5.17. PubMed PMID:18429245. 3. Ptashne, M. (1992). A Genetic Switch: Phage (Lambda) and Higher Organisms...
Showing: 41 - 60 of 151 results