Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 26 results for: 199

Showing: 1 - 20 of 26 results

  1. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato ...pyogenes 25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato ... pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS...pyogenes 25619936 Sato IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato IL1RN...pyogenes 25619936 Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted...pyogenes 25619936 Sato MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato ...pyogenes 25619936 Sato MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato ...

  2. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Mouse IgG2a 199396 Anti-Nav1.2 Na+ channel [K69/33R] Nav1.2 Na+ channel Rat Mouse IgG2a 199397 Anti-Gephyrin...IgG2a 199398 Anti-Gamma-protocadherin-A3 [N144/17R] Gamma-protocadherin-A3 Rat Mouse IgG2a 199399 Anti-...Mouse IgG2a 199400 Anti-Kv1.7 K+ channel [N471/27R] Kv1.7 K+ channel Rat Mouse IgG2a 199401 Anti-VAPA [...Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404 Anti-Kv2.1...Rat Mouse IgG2b 199407 Anti-Ankyrin-G [N106/36R-2b] Ankyrin-G Human Mouse IgG2b 199408 Anti-Kir2.1 K+ ...channel Rat Mouse IgG2b 199409 Anti-RGS14 [N133/21R-2b] RGS14 Rat Mouse IgG2b 199410 Anti-GFAP [N206A/8R-... IgG2b 199412 Anti-Cav1.2 Ca2+ channel [N263/31R-2b] Cav1.2 Ca2+ channel Rat Mouse IgG2b 199413 Anti-Arl13b...

  3. Tetracycline Inducible Expression

    Type
    Collection
    ...herpes simplex virus VP16 protein (Gossen and Bujard, 1992). This work also introduced the TRE, placing seven...-repressible system. Tetracycline On (Tet-On) In 1995, Gossen et al. used random mutagenesis to identify...developed by Clontech, based on Resnitzky et al., 1994). TRE3G promoter : also optimized into P TRE3GV ...opens in a new window) Gossen, M., & Bujard, H. (1992). Tight control of gene expression in mammalian ...Bender, G., Müller, G., Hillen, W., & Bujard, H. (1995). Transcriptional activation by tetracyclines in...Resnitzky, D., Gossen, M., Bujard, H., & Reed, S. I. (1994). Acceleration of the G1/S phase transition by expression...1669–1679. https://doi.org/10.1128/mcb.14.3.1669-1679.1994 (Link opens in a new window) PMID: 8114703 (Link...

  4. Brain Armamentarium

    Type
    Collection
    ...interneuron-targeting enhancer Gordon Fishell Viviana Gradinaru 199777-PHPeB AiP13781 - pAAV-AiE0452h-minBG-iCre(R297T...pathway D2-MSNs Jonathan Ting Viviana Gradinaru 199776-PHPeB AiP13779 - pAAV-AiE0779m_3xC2-minBG-iCre(...pathway D1-MSNs Jonathan Ting Viviana Gradinaru 199775-PHPeB AiP13778 - pAAV-AiE0450h-minBG-iCre(R297T...medium spiny neurons Jonathan Ting Viviana Gradinaru 199774-PHPeB AiP13905 - pAAV-AiE0441h_3xC2-minBG-SYFP2...medium spiny neurons Jonathan Ting Viviana Gradinaru 199773-PHPeB AiP13863 - pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3...

  5. Caltech Systemic Capsids

    Type
    Collection
    ...(Alias: CN2610) minBG SYFP2 Control AIBS , Ting 199773 AiP13863 - pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3-BGHpA...(Alias: CN3863) minBG SYFP2 Control AIBS , Ting 199774 AiP13905 - pAAV-AiE0441h_3xC2-minBG-SYFP2-WPRE3...4X2C-WPRE3-BGHpA minBG iCre expression iCre Ting 199775 AiP13778 - pAAV-AiE0450h-minBG-iCre(R297T)-BGHpA...) minBG iCre(R297T) expression iCre AIBS , Ting 199776 AiP13779 - pAAV-AiE0779m_3xC2-minBG-iCre(R297T)...) minBG iCre(R297T) expression iCre AIBS , Ting 199777 AiP13781 - pAAV-AiE0452h-minBG-iCre(R297T)-BGHpA...

  6. Rett Syndrome

    Type
    Collection
    ... of all Rett syndrome cases. Research Milestones 1992 - MECP2 is discovered by Adrian Bird's lab. (Link...Link opens in a new window) PMID: 1606614 1999 - Huda Zoghbi's lab identifies MECP2 as the genetic cause...Rett syndrome. (Link opens in a new window) PMID: 29019980 Return to top Animal Models Studies of the MECP2... window) Rettsyndrome.org References Amir et al. 1999. Rett syndrome is caused by mutations in X-linked...

  7. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...SYFP2 DRD1 Medium spiny neurons (D1-MSN) Striatum 199776 pAAV-AiE0779m_3xC2-minBG-iCre(R297T)-BGHpA AiP13779...SYFP2 DRD2 Medium spiny neurons (D2-MSN) Striatum 199777 pAAV-AiE0452h-minBG-iCre(R297T)-BGHpA AiP13781 ...AiE0784m SYFP2 Medium spiny neurons (MSN) Striatum 199774 pAAV-AiE0441h_3xC2-minBG-SYFP2-WPRE3-BGHpA AiP13905...AiE1419m SYFP2 Pvalb_Pthlh interneurons Striatum 224199 pAAV-AiE1419m-minBG-iCre(R297T)-BGHpA AiP15508 ...

  8. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...Bac-to-Bac Baculovirus Expresion vector 26117 pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106...Hexahistidine tag with TEV cleavage, KanR 26105 pNIC-CTHF EF199844 Hexahistidine tag, FLAG tag with TEV cleavage,... Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with TEV cleavage, AmpR 26095...

  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... tac ALS Sascha Martens 199205 pBMN-HA-TBK1 TBK1 HA ALS Sascha Martens 199206 pBMN_HA-TBK1 (kinase dead... ALS Sascha Martens 199207 pBMN_HA-TBK1 (E696K) TBK1 HA ALS Sascha Martens 199399 Anti-PINK1 [N4/49R] ... CMV Parkinson's Mark Cookson 25368 2XMyc-LRRK2-D1994A LRRK2 Myc CMV Parkinson's Mark Cookson 25369 2XMyc-LRRK2...-EGFP construct5 TARDBP GFP CMV ALS Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang...minigene MAPT CMV Parkinson's, FTD Stefan Stamm 121992 pHBS941 TDP43 RRM-GFP VLIMFYW-S TARDBP CMV ALS ...Parkinson's Maik Hintze 161584 pPuro3.1(+)_Strep-Lrrk2(D1994S)-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze...Bradley Hyman 226389 pcDNA3.1(-).TagRFP.T-2A-V5-S199D.Tau2N4R-WPRE MAPT TagRFP, T2A, V5 CMV, T7 Parkinson'...

  10. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...purified as described previously in Stachelhaus et al. (1998) References George N, Pick H, Vogel H, Johnsson ...Stachelhaus T, Mootz HD, Bergendahl V, Marahiel MA.1998. Peptide bond formation in nonribosomal peptide ...

  11. Immunology Research Plasmids and Resources

    Type
    Collection
    ... 9 (glia-activating factor) GAF, HBFG-9, MGC119914, MGC119915 FGFR1 fibroblast growth factor receptor ...FLJ26296, IGK, IGKC, MGC22645, MGC27376, MGC40426, MGC71990 IGKC immunoglobulin kappa constant HCAK1, Km, ...MGC129973, TER1 CCR9 chemokine (C-C motif) receptor 9 CDw199, GPR-9-6, GPR28 CCRL1 chemokine (C-C motif) receptor-like...insulin-like family peptide receptor 3 GPCR135, MGC141998, MGC142000, RLN3R1, RXFPR3, SALPR SAA1 serum amyloid...insulin-like family peptide receptor 3 GPCR135, MGC141998, MGC142000, RLN3R1, RXFPR3, SALPR RXRA retinoid...

  12. p53 Pathway

    Type
    Collection
    ..., Sidransky D, Vogelstein B, Harris CC. Science. 1991 Jul 5;253(5015):49-53. PubMed PMID: 1905840 . Recruitment...Gardner K, Giordano A, Levine AS, Kelly K. Nature. 1997 Jun 27;89(7):1175-84. PubMed PMID: 9215639 . Mutant...

  13. The Pleiades Promoter Project

    Type
    Collection
    ...EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS Ple53 DCX pEMS1524 intron-lacZ/NLS Ple54...pEMS1135 EGFP/NLS Ple198 SLC6A4 pEMS1136 EGFP/NLS Ple199 SLC6A5 pEMS1406 EGFP/NLS Ple200 SLC6A5 pEMS1096...

  14. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... Human lncRNA Splicing-targeting CRISPR Library 119977 Knockout Human Wei 3rd Varies 126,773 Human mTORC1...CHyMErA Paralog & Dual-targeting hgRNA pooled library 155199 Knockout Human Moffat Blencowe 3rd variable 92,...

  16. Brain Initiative Collection

    Type
    Collection
    ... after Cre-dependent recombination. Ofer Yizhar 202199-AAV1 pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE...promotor after Cre-dependent recombination Ofer Yizhar 202199-AAV5 pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE...

  17. Neuroscience

    Type
    Collection
    ...is supported by a NIH BRAIN Initiative grant (U24NS119916). The content of this web page is solely the ...

  18. All Antibodies

    Type
    Collection
    ...is supported by a NIH BRAIN Initiative grant (U24NS119916). The content of this web page is solely the ...

  20. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...activity . Development, 148(12). doi: 10.1242/dev.199399. PMID: 34143204 Goodson, N. B., Kaufman, M. A.,...
Showing: 1 - 20 of 26 results