Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 76 results for: 4-Oct

Showing: 41 - 60 of 76 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ...effectors for Tet transregulators . BioTechniques, 37 (4), 546–550. https://doi.org/10.2144/04374BM04 (Link...TetO-FUW-OSKM Tet-On inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf...-tetO-hOKMS Tet-On inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei...

  2. Negotiating Work and Life: How to Find the Joy

    Type
    Blog Post
    ...people have regular schedules. Work 8 to 5 or 7 to 4 or maybe 7 to 6 and 8 to 10 or whatever works for ...carefully and with attention to those around you #4 Thou shalt not bear the burden alone You, alone, are...And, yes, your partner CAN take the kids to the doctor without your help. Your partner is equally responsible...eight-year-old daughter vehemently reminded her doctor that she was allergic to penicillin – I am much...

  3. Mesothelioma - Causes, Symptoms, and Treatment

    Type
    Blog Post
    ...spread (metastasize) and turned into Stage 3 or Stage 4 cancer. These later stages of a cancer diagnosis indicate... is large in size and may have spread while Stage 4 indicates that the cancer has spread from where it... for years, or they are exposed even one time. Doctors and researchers don’t entirely understand why some...exposed to asbestos Tests like these will allow doctors not only to detect mesothelioma much earlier, thus...

  5. The Materials Science of Optogenetics Experiments

    Type
    Blog Post
    ...optogenetic implants have been reported by several groups [4, 5, 6]. These have the obvious advantage of not requiring...PMID: 23042500; PubMed Central PMCID: PMC3466483. 4. Kim TI, et al. Injectable, cellular-scale optoelectronics...University of Michigan and he is currently a Postdoctoral Fellow in the lab of Mary Jeanne Kreek at the...

  6. Make a Splash: Notions of Scientific Impact Are Evolving

    Type
    Blog Post
    ...of 39 Scientific Impact Measures" (2009) PLOS One 4(6): e6022. doi: 10.1371/journal.pone.0006022 Aragon...been gaining ground. A study issued by Google in October entitled “Rise of the Rest: The Growing Impact ...

  7. Production of Virus in Insect Versus Mammalian Cells

    Type
    Blog Post
    ...insectspodoptera frugiperda (lepidoptera; noctuidae). In Vitro, 13(4), 213–217. https://doi.org/10.1007/bf02615077...38 kb Cells HEK-293T Sf9 Time to collection 2–4 days 5–10 days Purification Ultracentrifugation ...

  9. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...PMID: 19396156. PubMed Central PMCID: PMC3655711. 4. Gronostajski, R M, and P D Sadowski. 1985. “The FLP...and Removed at Persistent Sites In Vivo.” Neuron 89(4): 756–69. PubMed PMID: 26853302. PubMed Central PMCID...guest blogger, Katrin Michel! Katrin Michel is a Postdoctoral Researcher at MIT and is fascinated by the question...

  10. Important Considerations in Optogenetics Behavioral Experiments

    Type
    Blog Post
    ...might be contextual fear conditioning (reviewed in [4]). Contextual fear conditioning is a behavioral experiment...PMID: 23473324. PubMed Central PMCID: PMC3595120. 4.Mattis, Joanna, et al. "Principles for applying optogenetic...University of Michigan and he is currently a Postdoctoral Fellow in the lab of Mary Jeanne Kreek at the...

  11. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...buffer. Additionally, protein lysis should be done at 4 °C or on ice, whichever is more practical. If your...protein-based blockers degrade fairly quickly, even at 4 °C, so when in doubt, make up a fresh batch.  Antibodies...temperature and time. Though the most common conditions are 4 °C overnight or room temperature for 1–2 hours, there...protein/sample loaded Incubate primary antibody at 4 °C overnight Incomplete washing Ensuring wash...resources with examples, like BioRad’s Western Blot Doctor page, or robust discussions, like ResearchGate’...

  12. What Do I Do Now? Academic v. Non-Academic Career Decisions

    Type
    Blog Post
    ...grant writing Job changes can happen regularly (every 4-6 years is common), but this can also bring new opportunities—projects...recently, I have been hearing exit survey data from postdoctoral programs in the Boston area that demonstrate...Both explicit and implicit aspects of today’s postdoctoral training can directly interfere with a seamless...

  13. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...Cardiovascular Research, 1(4), Article 4. https://doi.org/10.1038/s44161-022-00046-4 Kumar, S. R., Miles, T... fold change in RNA and DNA levels (~25-fold and ~4-fold respectively) relative to AAV9 in the pigtail...nervous system. Current Research in Neurobiology, 4, 100086. https://doi.org/10.1016/j.crneur.2023.100086...106–115. https://doi.org/10.1038/s41593-021-00969-4 Goertsen, D., Goeden, N., Flytzanis, N. C., & Gradinaru...enhanced transgene expression in the macaque CNS. Med, 4(1), 31-50.e8. https://doi.org/10.1016/j.medj.2022.11.002.... R., Flytzanis, N. C., Goeden, N., Christopher Octeau, J., Roxas, K. M., Chan, K. Y., Scherrer, J., Winchester...

  14. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

    Type
    Blog Post
    ...Nature Biotechnology, 41(4), 500–512. https://doi.org/10.1038/s41587-022-01527-4 Additional resources on... 149–157. https://doi.org/10.1038/s41586-019-1711-4 Chen, P. J., Hussmann, J. A., Yan, J., Knipping, F...post was originally written by Jennifer Tsang in October 2019 and updated by Emily P. Bentley in December...

  15. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912... Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens ...GTGAATGATGATAATACGAT 64160 activate S. pyogenes 25619936 Sato Oct4A (POU5F1) H. sapiens GGGGCGCCAGTTGTGTCTCC 50922 interfere... interfere S. pyogenes 24346702 Wolfe Oct4A (POU5F1) H. sapiens GTGGGACTGGGGAGGGAGAG 50921 interfere S...CGAAATGAGAAAGGGAGCTACAAC 47869 cut N. meningitidis 23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N....

  16. X-CHIME: Context Dependent Germline Knockout in Immune Cells

    Type
    Blog Post
    ...1335–1347. https://doi.org/10.1038/s41590-019-0480-4 LaFleur, M. W., Nguyen, T. H., Coxe, M. A., Yates,... X-CHIME plasmids here!   Marty LaFleur is a Postdoctoral Fellow in Arlene Sharpe’s laboratory at Harvard...

  17. Screening for Successful Genome Editing with Digital PCR

    Type
    Blog Post
    ...Protoc 11, 598–615 (2016). PubMed PMID: 26914317. 4. Mock, U. et al. mRNA transfection of a novel TAL ...This post was contributed by Scott Findlay, a Postdoctoral Fellow at the University of Alberta. If you’... out of frame! Scott Findlay is currently a Postdoctoral Fellow at the University of Alberta. He is interested...

  18. dTAG - You're it!

    Type
    Blog Post
    ...degradation of endogenous proteins (notably, BRD2/3/4, CDK9, TRIM24, FLT3, BTK, and ALK) by linking small...contributed by guest blogger Behnam Nabet, a postdoctoral fellow at Dana-Farber Cancer Institute. Targeted...studies (Nabet et al.).   Behnam Nabet, PhD is a postdoctoral fellow at the Dana-Farber Cancer Institute. ...

  20. Four Factors that Differentiate the Stem Cell Field

    Type
    Blog Post
    ...Something in their world should be fast and affordable. 4. Stem cell scientists are generous Besides some of...differentiated cells simply by expressing four proteins Oct4, Sox2, Klf4, and cMyc (the so called OSKM factors...
Showing: 41 - 60 of 76 results