Skip to main content
Addgene

We narrowed to 1,023 results for: Cat

Showing: 41 - 60 of 1023 results
  1. Measuring Kinase Activity at the Single-Cell Level with Kinase Translocation Reporters (KTRs)

    Type
    Blog Post
    ...phosphatase-accessible. Kinase Translocation Reporters (KTRs) Kinase Translocation Reporters (KTRs) are genetically...provides an alternative tool with their Kinase Translocation Reporters (KTRs) whose cellular localization...activity is enhanced, leading to cytoplasmic translocation of the reporter. As a result, the KTR is shuttled...nuclear export and import rates can influence KTR translocation. Work from the Covert lab suggests that these... negligible effect on KTRs, however nuclear translocation rates are another variable to consider when ...measurements of kinase activity in single cells using translocation reporters. Nature protocols, 13 1, 155-169. ...
  2. Arabidopsis in Education: How the Arabidopsis Biological Resource Center Brings Plant Science to Life

    Type
    Blog Post
    ... Our education partnerships have grown to include local school districts, professional education associations...contributed by guest blogger Courtney Price, the Education & Outreach Specialist for the Arabidopsis Biological...resources for Arabidopsis and related species. Located at The Ohio State University in Columbus, Ohio,... more than 100,000 samples to researchers and educators in 60 countries each year. Introducing Arabidopsis...outreach program kicked off with the release of 20 education kits designed for use in K-12 and college-level...Translating Research on Arabidopsis Into a Network of Educational Resources). Arabidopsis is used in research to...blogger, Courtney Price!  Courtney Price is the Education & Outreach Specialist for the Arabidopsis Biological...
  3. Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

    Type
    Blog Post
    ...voltage indicator Archon Article contributed by Shreya Vedantam  Listen to the voltage indicator podcast... genetically encoded voltage indicators. To expand the voltage indicator toolbox, Ed Boyden’s lab developed...customized for protein visualization, relocation, degradation, modification, and scaffolding. In their study...xCas9, and requires no additional chemicals or modifications. This versatility opens up the potential for...Archon1, a novel opsin-based fluorescent voltage indicator. Archon1 can embed itself into the cell membrane...response to blue light (445nm). The discovery and applications of protein partners that bind to only the light...
  4. Early Career Researcher Toolbox: Social Media for Scientists

    Type
    Blog Post
    ... writing for the Addgene blog, sharing Chemistry Cat memes was how I used social media as a scientist....needed to start using Twitter. Sharing Chemistry Cat memes use to be how I used social media as a scientist...remotely as an Addgene Science Communication Intern. Developing science communication skills, while also learning... on a panel about “Social Media for Science Communication” at the American Society for Cell Biology (ASCB...Twitter Learn about using Reddit for science communication ...
  5. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...GpNLuc and OgNLuc are available through Addgene (Cat.# 70185 and 70186, respectively). Antares Chu, J...construct for Antares is available through Addgene (Cat. # 74279). Enhanced Nano-Lanterns  Suzuki, K., et...et al (2). In this post, I’ll cover two great applications of the NLuc technology. The first couples NLuc...fluorescence. The paper reports a wide variety of applications of the Enhanced Nano-Lanterns including monitoring...2017) Genetically encoded bioluminescent voltage indicator for multi-purpose use in wide range of bioimaging...
  6. Cultivating Community Science at BosLab

    Type
    Blog Post
    ...Experimenting in an Open Source Lab: from CRISPR to Cats Stem Cell Models for Disease & Open Science: Interview...state of Massachusetts. Because we’re conveniently located next to a major Biotech hub, building up our lab...pipetting experience. However, after a few months of dedicated time at BosLab, he became our bacterial transformation...projects range from hacking probiotics to filming educational lab videos, while some are looking to develop...microbial diversity in different soil conditions/locations but to engage the local community (including local...Order Plasmids from Addgene! Find Free and Open Educational Resources at Addgene! ...
  7. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...biotechnologists face is public perception of genetic modification (GM) and synthetic biology. The mistrust and...cannot build what we do not understand, and the complicated and unique metabolic processes of plants are ...
  8. Story of a SynBio Startup: RevBio's Epiphany (or Lack Thereof)

    Type
    Blog Post
    ...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...plants engineered to detect explosives and rapidly indicate their presence. They are genetically modified ...enjoy and see a future in. And we decided to make education and outreach a cornerstone of our business, because...
  9. Technique: Probe Phage Genomes for Host Binding Proteins

    Type
    Blog Post
    ...spending time with her horse, and wondering what her cat is thinking. Find her on Twitter @JessicaSacher. ... whole genome amplification (by a mechanism known as multiple displacement amplification) even in the ...same location that their host colonies grew. If your cells of interest stick to the same location as a...adding methyl groups, glycosyl groups, and other modifications to their bases in order to protect their DNA...DNA from host cell nucleases (4). To further complicate matters, even when sequenced, phage genomes tend...compressed nitrogen gas; this shears DNA at random locations and allows for a given fragment size to be selected... for physical shearing exist as well, such as sonication and needle shearing. Essentially, any method ...
  10. DNA Quantification

    Type
    Protocol
    ... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...
  11. CRISPR Library Amplification

    Type
    Protocol
    ... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities...
  12. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    .... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ...
  13. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...
  14. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TCTAATTGGTCTGTACCTaaagtggccgctaaggAAGCCCCCTGGGCTGATA lycat TAL3482 & TAL3483 TCCTTCATCTTCATCCAGcggcgctgggaggacgACCGCACACACATGAGCA lyl1 TAL3110...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...TAL3017 TGTTTCTGGCGGACTCTCgtcaccattcttctgtTTGAAGGCACACCTTTGA ahcyl1 TAL3018 & TAL3019 TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA...Aminopeptidase-o TAL3020 & TAL3021 TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA... arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA apoa4 TAL3022 & TAL3025 ...TAL3025 TGGCAGGACCAACCAATGcccagcatggacctggTGAAAAATGCTTTCTGGA apoa4-like TAL3023 & TAL3024 TGAAGGTTCTTGTGGTGCtcacacttgctgtggtTACAGGTAAGAAACTAAA...arap3a TAL3026 & TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA ARSA TAL 3002 & TAL 3003...
  15. Validated gRNA Sequences

    Type
    Collection
    ...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...
  16. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...encoded sensor and small molecule indicator: implications for quantification of cytosolic Zn(2+). ACS Chem... few popular categories of biosensors or browse all the biosensors tagged in our catalog . Use the article...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal...
  17. CRISPR Guide

    Type
    Collection
    ... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the...
Showing: 41 - 60 of 1023 results