Skip to main content

We narrowed to 59 results for: cag promoter

Showing: 41 - 59 of 59 results
  1. Binning Singletons: Tackling Conference Networking When You Don’t Know Anyone

    Type
    Blog Post
    ... of the people who participated as mentors or promoters were connected to that Tweet Up in 2013. These...connections brought in folks I didn’t yet know and promotion from those who could not participate but provided...BinningSingletons mixer with new friends @iprophage @robincagle5 pic.twitter.com/52KQDMeSjO — Brianna Weiss (@... even more valuable program to Microbe 2020 in Chicago.  Finding our place in networking and mentoring...
  2. Hot Plasmids and Viral Preps - May 2021

    Type
    Blog Post
    ...to measure time. These plasmids with different promoters driving expression of Cas9 were used in this study...ready-to-use AAV vectors expressing GCaMP6f with this promoter. Image calcium transients in PV interneurons with....org/10.1074/jbc.RA120.01289     Novel protein cage provides simple enzyme protection in yeast bioproduction...
  3. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components...enzymatic activity. In addition, proteins can be “caged” by fusion to specific domains thereby rendering... The authors use PhoCl in combination with this caging technique to beautifully demonstrate light-dependent...
  4. Identifying Sequence Elements with SnapGene's Feature Database

    Type
    Blog Post
    ...straightforward to define, but for control elements such as promoters and transcription terminators, the boundaries ...Genetics and Cell Biology at the University of Chicago. He was an early depositor at Addgene, and conceived...
  5. Promoters

    Type
    Guide
    ...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; contains CMV...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... binding to the promoter region. Each sigma factor recognizes different core promoter sequences. Figure...
  6. How to Design Your gRNA for CRISPR Genome Editing

    Type
    Blog Post
    ...nuclease-dead Cas9 (dCas9) is directed near the promoter of a target gene. Here, the target window is not... shown that the FANTOM database, which relies on CAGE-seq to directly capture the mRNA cap, provides the...
  7. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid.... Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau et al. (2009...packaging construct encoding tat . Jakob Reiser 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur...
  8. Chemogenetics Guide

    Type
    Guide
    ...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted Expression Depending ...
  9. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    .... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG...Enzymes: EcoR1 , NotI , Spel Suffix: GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT... EcoR1 , NotI , XbaI Suffix: T ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA..., (NgoMIV) Suffix: ACCGGT TAAT ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: Agel , Spel , Notl, Pstl Scar: ...
  10. Molecular Biology Reference

    Type
    Guide
    ...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...check out our promoters reference page . Selectable Marker Used to select for cells that have successfully...
  11. Plant Plasmids and Resources

    Type
    Collection
    ...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI...Addgene’s collection includes plasmids containing promoters that drive general and species-specific gene expression...constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal... (Link opens in a new window) — The initiative promotes interdisciplinary exchange, open technologies,...CRISPR. Successfully validated in tomato, tobacco, Medicago truncatula , wheat, and barley. Return to top ...
  12. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...Nopaline synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward...
  13. Immunology Research Plasmids and Resources

    Type
    Collection
    ... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon receptor GGR, MGC138246 GDF1 growth...MGC70354, foveolin GLP1R glucagon-like peptide 1 receptor MGC138331 GLP2R glucagon-like peptide 2 receptor...
Showing: 41 - 59 of 59 results