We narrowed to 565 results for: mme

...ID Plasmid Description PI 1733 pCI-VSVG VSV-G recommended for the FELIX (FIV-based) system. Garry Nolan...

...neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb Collection . Once the plasmids...

...Learn More ID Recombinant Antibody Reactivity Recommended Applications PI Don't See What You're Looking...

...The Voytas/Bogdanove TALEN kit came online in the summer of 2011 and has already become the best-selling...

...purification ( pET28a-LIC or other pET vectors are recommended). The selection marker for all plasmids in this...

...ID Plasmid Description PI 1733 pCI-VSVG VSV-G recommended for the FELIX (FIV-based) system. Garry Nolan...

...et al. first demonstrated that CRISPR could be programmed for targeted DNA cleavage in vitro. In 2013, ...

...with the guide RNA. For most applications, we recommend using Cas9 with the single guide RNA (sgRNA), ...

...reprogramming” of the cell to an embryonic state holds immense potential for drug development, disease modeling...

...delivery and the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature...

...Periplasmic space PelB signal sequence YFP Thorben Dammeyer 54520 mCherry-Peroxisomes-2 Peroxisomes Peroximal...

...bacterial cultures . Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin...which are deadly to humans. Most of all common, commercial lab strains of E. coli used today are descended...included a small number of E. coli strains below and recommend checking out Addgene’s blog posts about common...antibiotics commonly used in the lab and their recommended concentrations. We suggest checking your plasmid's...

...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-F TTGCCTTTCTCTCCACAGGT...

...the rest of the genome The target is present immediately adjacent to a P rotospacer A djacent M otif (...well as additional DNA matching the sequence immediately upstream and downstream of the target site (termed...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be problematic.... T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan...

...DREADDs and LMOs have been developed and are commercially available. Table 4: Common promoters in chemogenetics...Carpenter, J. C., Snowball, A., Knauss, S., von Schimmelmann, M., During, M. J., Lignani, G., Schorge, S....

...next-generation sequencing of the maxiprep DNA is recommended to verify that the library is complete — an incomplete...

...keep up with the demand of clinical studies and commercial purposes. The use of helper-free production cell...

...delivery and the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature...

...activated kinase 7 KIAA1264, MGC26232, PAK5 PDCD1 programmed cell death 1 CD279, PD1, SLEB2, hPD-1, hPD-l ...

...validation of some of these tools created by the Trimmer Lab that will be the first antibodies distributed...constructing the plasmids for expression of mAbs, the Trimmer lab isolated RNA from cryopreserved hybridomas,...can be a threat to future reproducibility. The Trimmer Lab found that in addition to recovering RNA from...lab’s entire hybridoma collection. Instead, the Trimmer Lab moved to direct functional validation by immunofluorescence-immunocytochemistry...subsequently cloned into the expression constructs. The Trimmer lab found that the recognition sequence for the...webpage. Importantly, the methods developed by the Trimmer Lab for construction and validation of R-mAb expressing...with different mAbs in the same experiment. The Trimmer Lab found that they could modify the CH encoding...