We narrowed to 568 results for: mme
-
TypeCollection...by purchasing coenzyme A disodium salt from a commercial supplier and conjugating it to the label of their...
-
Retrovirus Plasmids
TypeCollection...ID Plasmid Description PI 1733 pCI-VSVG VSV-G recommended for the FELIX (FIV-based) system. Garry Nolan... -
Antibody Plasmid Collection
TypeCollection...neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb Collection . Once the plasmids... -
Distribution to Industry
TypeCollection...Learn More ID Recombinant Antibody Reactivity Recommended Applications PI Don't See What You're Looking... -
CRISPR Plasmids - Bacteria
TypeCollection... non-specific cleavage is thought to activate programmed cell death or dormancy for phage-infected bacterial... -
TALEN Guide
TypeCollection...The Voytas/Bogdanove TALEN kit came online in the summer of 2011 and has already become the best-selling... -
Open Enzyme Collection
TypeCollection...purification ( pET28a-LIC or other pET vectors are recommended). The selection marker for all plasmids in this... -
Lentivirus Plasmids
TypeCollection...ID Plasmid Description PI 1733 pCI-VSVG VSV-G recommended for the FELIX (FIV-based) system. Garry Nolan... -
CRISPR History and Development for Genome Engineering
TypeCollection...et al. first demonstrated that CRISPR could be programmed for targeted DNA cleavage in vitro. In 2013, ... -
Zhang Lab CRISPR Page
TypeCollection...with the guide RNA. For most applications, we recommend using Cas9 with the single guide RNA (sgRNA), ... -
Plasmids for Stem Cell Research
TypeCollection...reprogramming” of the cell to an embryonic state holds immense potential for drug development, disease modeling... -
CRISPR Pooled gRNA Libraries
TypeCollection...Mouse Metabolism Library 163966 Knockout Mouse Kimmelman 3rd ~6 18,343 Human UBDUB CRISPR Knockout Library... -
Plan Your Experiment
TypeCollection...delivery and the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Periplasmic space PelB signal sequence YFP Thorben Dammeyer 54520 mCherry-Peroxisomes-2 Peroxisome Peroximal... -
Molecular Biology Reference
TypeGuide...bacterial cultures . Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin...which are deadly to humans. Most of all common, commercial lab strains of E. coli used today are descended...included a small number of E. coli strains below and recommend checking out Addgene’s blog posts about common...antibiotics commonly used in the lab and their recommended concentrations. We suggest checking your plasmid's... -
Sequencing Primers
TypeGuide...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-F TTGCCTTTCTCTCCACAGGT... -
CRISPR Guide
TypeGuide...the rest of the genome The target is present immediately adjacent to a P rotospacer A djacent M otif (...well as additional DNA matching the sequence immediately upstream and downstream of the target site (termed...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be problematic.... T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan... -
Chemogenetics Guide
TypeGuide...DREADDs and LMOs have been developed and are commercially available. Table 4: Common promoters in chemogenetics...Carpenter, J. C., Snowball, A., Knauss, S., von Schimmelmann, M., During, M. J., Lignani, G., Schorge, S.... -
Guide to Using Pooled Libraries
TypeGuide...next-generation sequencing of the maxiprep DNA is recommended to verify that the library is complete - an incomplete... -
Gamma-Retroviral Vector Guide
TypeGuide...keep up with the demand of clinical studies and commercial purposes. The use of helper-free production cell...