We narrowed to 560 results for: mme
-
TypeCollection...envelope plasmid Trono 1733 pCI-VSVG Envelope VSV-G recommended for the FELIX (FIV-based) system Nolan 35617 ...
-
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...by purchasing coenzyme A disodium salt from a commercial supplier and conjugating it to the label of their... -
Distribution to Industry
TypeCollection...Learn More ID Recombinant Antibody Reactivity Recommended Applications PI Don’t See What You’re Looking... -
Antibody Plasmid Collection
TypeCollection...neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb Collection . Once the plasmids... -
CRISPR Plasmids - Bacteria
TypeCollection... non-specific cleavage is thought to activate programmed cell death or dormancy for phage-infected bacterial... -
TALEN Guide
TypeCollection...The Voytas/Bogdanove TALEN kit came online in the summer of 2011 and has already become the best-selling... -
Open Enzyme Collection
TypeCollection...purification ( pET28a-LIC or other pET vectors are recommended). The selection marker for all plasmids in this... -
Lentivirus Plasmids
TypeCollection...plasmids Weinberg 1733 pCI-VSVG N/A Envelope VSV-G recommended for the FELIX (FIV-based) system Nolan 22502 ... -
CRISPR History and Development for Genome Engineering
TypeCollection...et al. first demonstrated that CRISPR could be programmed for targeted DNA cleavage in vitro. In 2013, ... -
Zhang Lab CRISPR Page
TypeCollection...with the guide RNA. For most applications, we recommend using Cas9 with the single guide RNA (sgRNA), ... -
CRISPR Pooled gRNA Libraries
TypeCollection...Mouse Metabolism Library 163966 Knockout Mouse Kimmelman 3rd ~6 18,343 Human UBDUB CRISPR Knockout Library... -
Plasmids for Stem Cell Research
TypeCollection...reprogramming” of the cell to an embryonic state holds immense potential for drug development, disease modeling... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Periplasmic space PelB signal sequence YFP Thorben Dammeyer 54520 mCherry-Peroxisomes-2 Peroxisome Peroximal... -
Molecular Biology Reference
TypeGuide...or LB agar plates. Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin...deadly to humans. The majority of all common, commercial lab strains of E. coli used today are descended...included a small number of E. coli strains below and recommend checking out these two Addgene blog posts relating...antibiotics commonly used in the lab and their recommended concentrations. We suggest checking your plasmid's...antibiotic powder can be dissolved in dH 2 0. Addgene recommends making 1000X stock solutions and storing aliquots... -
Sequencing Primers
TypeGuide... CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT... CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT... -
CRISPR Guide
TypeGuide...the rest of the genome The target is present immediately adjacent to a P rotospacer A djacent M otif (...well as additional DNA matching the sequence immediately upstream and downstream of the target site (termed...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be problematic.... T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan... -
Chemogenetics Guide
TypeGuide...DREADDs and LMOs have been developed and are also commercially available. Browse our collection of Ready-to-use...Mouravlev A, Carpenter JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D,... -
Guide to Using Pooled Libraries
TypeGuide...next-generation sequencing of the maxiprep DNA is recommended to verify that the library is complete - an incomplete... -
Gamma-Retroviral Vector Guide
TypeGuide...keep up with the demand of clinical studies and commercial purposes. The use of helper-free production cell... -
Immunology Research Plasmids and Resources
TypeCollection...activated kinase 7 KIAA1264, MGC26232, PAK5 PDCD1 programmed cell death 1 CD279, PD1, SLEB2, hPD-1, hPD-l ...