...development of pseudoviruses for enveloped viruses. Rev Med Virol 28:e1963 . https://doi.org/10.1002/rmv.1963...For more details, check out this review article published in Reviews in Medical Virology (Li et a., 2018...ultracentrifugation which helps scientists achieve a high titer (reviewed in Joglekar and Sandoval, 2017). This high titer...can be used for specific purposes as described previously (Table 1, Gutierrez-Guerrero, et al, 2020). Because...travel retrogradely, and jump the synapse to the previous neuron (Wichersham et al., 2007). However, once...specific to suit your needs. Check out some of these review articles to find tables and information on different...

...genome. The packaging plasmid contains Gag, Pol, Rev, and Tat genes. Specifically for our knowledge here...integration, and how researchers have modified them to prevent this integration.  Lentiviruses evolved to integrate... continue. They rely on a viral protein called reverse transcriptase to convert their RNA genomes into...viral genome is then part of the cellular DNA… forever!  This can be an advantage for researchers looking...integrase-deficient lentiviral vectors, let’s briefly revisit the basic biology of lentiviral vectors (for a ...processed from the larger protein: PR (protease), RT (reverse transcriptase), and IN (integrase). These viral... viral life cycle initially proceeds as usual. Reverse transcription of the transgene occurs in the cytoplasm...

...plasmid: Gag, Pol, Rev, Tat Two plasmids: one encoding Gag and Pol and another encoding Rev Envelope Plasmid...one packaging plasmid and rev from another, such as pMDLg/pRRE and pRSV-Rev . 3rd generation packaging...by Nucleocapsid. RRE in cis Rev Response Element; sequence to which the Rev protein binds. WPRE in cis ...Precursor protein containing Reverse Transcriptase and Integrase components. Rev in trans On separate plasmid... single packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains the... system is split into two plasmids: one encoding Rev and one encoding Gag and Pol. Although safer, this...generation packaging systems: express the HIV gag, pol, rev, and tat genes all from a single packaging plasmid...

...PCR tubes. Put 50µl – 2.5µl (fwd primer) – 2.5µl (rev primer) = 45µl volume of master mix to add to each...primers for 30 seconds at 55°C: The forward and reverse primers are stable within this temperature range...nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 36.8 μL Sterile dH 2 O 0.2...nt) 2.5 μL Forward Primer (10 μM stock) 2.5 μL Reverse Primer (10 μM stock) 0.2 μL Taq DNA Polymerase ...DNA can be added to the master mix. Forward and Reverse Primers DO NOT get added to a master mix. Place...several times. Keep tube on ice. Add the forward and reverse primers to the thinned walled PCR tubes. Note: ... primer onto one side of the tube wall and the reverse primer onto the other. Add the master mix to the...

...–Cas in agriculture and plant biotechnology. Nat Rev Mol Cell Biol 21:661–677 . https://doi.org/10.1038...cytosine base editor or adenine base editor) and reverse transcriptase-mediated prime editing technologies...precise edits tend to be more efficient than HDR (reviewed in Zhu et al., 2019). Both cytosine base editors...Lew TTS, Sweeney CJ, Koman VB, Wong MH, Bohmert-Tatarev K, Snell KD, Seo JS, Chua N-H, Strano MS (2019)...

...Eukaryotic Genomes. Annu Rev Genet 41:331–368. https://doi.org/10.1146/annurev.genet.40.110405.090448 Kumar...transcripts and then rely on a reverse transcriptase enzyme to reverse transcribe back into DNA before...another. This protein is either a transposase or a reverse transcriptase, depending on the mechanism of transposition...: gag and pol. The pol polyprotein encodes the reverse transcriptase and integrase enzymes which are required... with a poly(A). ORF2 encodes endonuclease and reverse transcriptase activities.    Figure 1: ...themselves as RNA transcripts and then use their reverse transcriptase (RT) enzyme to convert back into ...need to move around, either a transposase or a reverse transcriptase. Non-autonomous transposons, however...

...RNA Interference. Annu Rev Biophys 42:217–239 . https://doi.org/10.1146/annurev-biophys-083012-130404 ...downstream of DNA, such as RNA interference, can reversibly exert their effect independent of gene copy number...techniques It is fair to say that CRISPR has revolutionized molecular biology and has enabled functional...same gene. However, recent work has called this prevalent assumption into question. Specifically, CRISPR-generated...DNA template for the RNAi trigger is the most prevalent method due to ease of use and capacity to generate...RNA Interference System in Physcomitrella patens Reveals a Dominant Role of Augmin in Phragmoplast Microtubule...

... 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-containing plasmid...water, then SYBR master mix, then the forward and reverse primers. Vortex briefly, immediately before use... μL 100 μM Forward Primer 0.15 μL 15 μL 100 μM Reverse Primer 0.15 μL 15 μL Nuclease Free Water 4.7 μL... made in step #1): Volume of 2 x 10 9 stock or previous dilution (μL) Volume of nuclease-free water (uL...

...ligases: structural and functional insights." Annu. Rev. Biochem. 77 (2008): 313-338. PubMed PMID: 18518823...structure, reaction mechanism, and function." Chemical reviews 106.2 (2006): 687-699. PubMed PMID: 16464020.  ...

... cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae GTTGAAAGTATTAGTTAAAG...70655 cut S. pyogenes 26472758 Sabatini CAN1 S. cerevisiae GATACGTTCTCTATGGAGGA 43803 cut S. pyogenes 23460208...interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949 Lu CYC1m promoter... promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m promoter S. ...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes...

...pAAV-EF1a-iCreV can be used to generate AAV virus that will express light-inducible site-specific iCreV recombinase...pAAV-EF1a-iDreV can be used to generate AAV virus that will expresslight-inducible site-specific iDreV recombinase...Neurotechnologies® (BRAIN) Initiative aims to revolutionize our knowledge of the human brain through the... behavior. Long desired by researchers, the revolutionary dynamic picture of the brain generated through...will provide novel ways to treat, cure, and even prevent brain disorders. The BRAIN Initiative supports ...

...strand. Determine the reverse complement of each guide sequence. Example reverse complement sequences ...25-mer oligos for each guide and its associated reverse complement including additional nucleotides for...mer guide sequence and “AAAC” before the guide’s reverse complement for cloning into the pX330 vector using...the CACC sequence. Add a C at the 3’ end of the reverse complement oligo ( e.g., sgRNA-A in Table 4 ). ... and do not add C to the final position of the reverse complement oligo. In this case, the resultant oligos... intended deletion). Use a pair of forward and reverse primers flanking each sgRNA target site (within...Prepare a 10 μl reaction mix for each guide and its reverse complement: 1.0 μl sgRNA 24- or 25-mer oligo (100...

...Ligases DNA Polymerases Restriction Endonucleases Reverse Transcriptases RNA Polymerases Other Enzymes (Link...DNA polymerases, RNA polymerases, DNA ligases, reverse transcriptases, and restriction enzymes. These ...reaction (PCR), cloning, isothermal amplification, reverse transcription of RNA into DNA, and dNTP synthesis...Ligases DNA Polymerases Restriction Endonucleases Reverse Transcriptases RNA Polymerases Other Enzymes DNA...pOpen-XbaIR XbaI 165568 pOpen-NcoIR NcoI Return to top Reverse Transcriptases Addgene ID Plasmid Gene/insert 165546...pOpen-MMLV_RT (mut H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase (RNAse H deactivated by 3 mutations... (lack H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase RNaseH - (lacking RNaseH domain) ...

...patterning of cGMP in vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad...Peredox-mCherry in plants In Vivo NADH/NAD+ Biosensing Reveals the Dynamics of Cytosolic Redox Metabolism in Plants...for pyruvate A highly responsive pyruvate sensor reveals pathway-regulatory role of the mitochondrial pyruvate...pHluorin Two pathways of synaptic vesicle retrieval revealed by single-vesicle imaging. Neuron. 2009 Feb 12...macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. J Cell Biol. 2010 Feb...for pH sensing The zebrafish merovingian mutant reveals a role for pH regulation in hair cell toxicity ...Lifetime imaging of a fluorescent protein sensor reveals surprising stability of ER thiol redox. J Cell ...

...Jarvik JW, Telmer CA. 1998. Epitope tagging. Annu Rev Genet 32: 601-618. PubMed PMID: 9928493. 4. Liang...low knock-in efficiency. Together, these factors prevent stem cell researchers from generating clonal knock-in...

... and mechanobiology: seeing is believing." Annu. Rev. Biomed. Eng. 10 (2008): 1-38. PubMed PMID:18647110... 570/ 596 Reversible photoactivation In contrast to irreversible PA-FPs, reversible PA-FPs (also known... into 2 main categories - those with irreversible and reversible photoactivation - and have enabled sophisticated...sophisticated imaging techniques.     Irreversible photoactivation Irreversible PA-FPs can be switched on from...another group of reversible PA-FPs. These were engineered to be the first reversible, monomeric red fluorescent...their fluorescence can be switched on and off reversibly. This ability to modulate fluorescence allows...takes less than a second. The first successful irreversible PA-FP reported was PA-GFP. PA-GFP was derived...

...the donor template, incorporating mutations that prevent further Cas9 cleavage will improve the accuracy... method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the C-terminus...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ...editing. PASTE uses a CRISPR-Cas9n fused to both a reverse-transcriptase and a serine integrase (Bxb1), along...dCas9-mediated gene activation or repression is reversible, as it does not permanently modify the genomic...multiple fusions. The effects of CRISPRi/a may be reversible once the effector is inactivated or removed from... and even cell differentiation. The system is reversible, with a companion CRISPRon to undo repression...

...140135 pAAV-EF1a-iCreV EF1a light-inducible recombinase iCreV Zeng 140136 pAAV-EF1a-iDreV EF1a light-inducible...strains. **AAV1-X1 has not been tested in rats. Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory...check out Addgene's blog on Systemic Capsids . To review performance data of each of these serotypes, please...light-inducible recombinase iDreV Zeng 140137 pAAV-EF1a-iFlpV EF1a light-inducible recombinase iFlpV Zeng 164450...

...search and replace” gene editing method in which a reverse transcriptase (RT) is fused to the C terminus of...the desired edit is incorporated into the DNA by reverse transcription. The edited DNA strand displaces ... use the Moloney murine leukemia virus (M-MLV) reverse transcriptase. Engineering of the PE enzyme and...editing, including exploring new sources for the reverse transcriptase. Many PE enzymes and related tools...additional protection added to 3’ tail of pegRNA to prevent RNA degradation For more in-depth information on...

...General Tools : Plasmids expressing Cas12a/Cas13a, Reverse Transcriptases, etc. that may be useful for detection...2020.06.23.166397 (Link opens in a new window) reverse transcriptase, protease, and Bst polymerase constructs...Enzymes. (unpublished) Taq polymerase and MMLV reverse transcriptase expression plasmids from the Drew...2020.03.29.013342 (Link opens in a new window) Reverse Transcriptase plasmids from Andrew Ellington's ...Plasmid form. If the plasmid has been described previously we will reach out to the lab to ask them to deposit...