Skip to main content

We narrowed to 604 results for: sam

Showing: 581 - 600 of 604 results
  1. Colony Formation Titering Assay

    Type
    Protocol
    ...protocol outlines the seeding of the cells at the same time as the virus-mediated transduction. For some... titer, take the average of multiple dilutions. Sample Data Figure 1: A549 cells were transduced with ...
  2. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...complete + 10 µg/mL polybrene. Note, this is just a sample of possible dilutions. You may want to try higher...monoclonal lines from the early polyclonal populations. Sample Data Figure 1: Generation of monoclonal cell lines...
  3. Antibody Guide

    Type
    Guide
    ...application Collect and lyse samples to make proteins available. Tissue samples may need additional processing...culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link the samples with formaldehyde...isotype. Overview of application Fix your samples. Prepare your samples using permeabilization, antigen retrieval...Blank controls in the form of sample buffer must also be run. Unique samples (non-biological replicates)...cultured B cells, where each culture should produce the same antibody clone, or from plasmid-based expression...factors, binding partners, location in the cell, and sample processing can hide or reveal epitopes on an antigen...contain antibodies targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally...
  4. CRISPR Guide

    Type
    Guide
    ...protein, instead of a two-component system (Figure 9C) SAM activators — co-expression of dCas9-VP64 with a modified... ensures that all gRNAs will be expressed in the same cell. This is called multiplexing , and increases...deletions or inversions with two gRNA sites on the same chromosome. Most multiplex systems enable researchers...sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to be efficiently...from Neisseria meningitidis ), which are about the same size as SaCas9, with higher fidelity than SpCas9... types of base edits: Base transitions — edit to same classification of nucleotide base (purine-to-purine...an enzyme evolved to excise inosine to access the same repair pathway and convert A to any other base. ...
  5. Protocol - How to Design Primers

    Type
    Protocol
    ...primer is used to amplify a eukaryotic genomic DNA sample. However, a primer should not be too long (> 30...
  6. Ligation Independent Cloning

    Type
    Protocol
    ...have different leader sequences, but operate on the same principle (homologous to the first G on 3'-5' strand...
  7. Fluorescence Titering Assay

    Type
    Protocol
    ... titer, take the average of multiple dilutions. Sample Data Figure 1: 293T cells were transduced with ...
  8. General Transfection

    Type
    Protocol
    ...24–48 h before checking for protein expression. Sample Data Legend: Lenti-X 293T cells were transfected...
  9. Lentivirus Production

    Type
    Protocol
    ... °C as soon as possible to avoid loss of titer. Sample Data Figure 1: 293T cells were transfected with...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...plasmids. Plasmids within a given library have the same backbone, but contain unique inserts. Some libraries...BioRender.com. Both positive and negative screens follow the same basic process. Before applying to cells, the library... screen: Apply library Perform NGS on a control sample (no selection) Apply selection; most cells will...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...with gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...
  12. Molecular Biology Reference

    Type
    Guide
    ... in a process called transcription. RNA uses the same nucleotide bases as DNA, except thymine is replaced...natural amino acids, so multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer... cells are called clones, since they contain the same genetic information as the parental cell. The plasmid...
  13. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant ...Link opens in a new window) Wu, Z., Asokan, A., & Samulski, R. J. (2006). Adeno-associated virus serotypes...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...
  14. Sequencing Primers

    Type
    Guide
    ... CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV... GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3...
  15. Molecular Cloning Techniques

    Type
    Guide
    ...side of it into any plasmid that has the same sites in the same orientation within its MCS. Due to their...
  16. Lentiviral Vector Guide

    Type
    Guide
    ...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...
Showing: 581 - 600 of 604 results