We narrowed to 604 results for: sam

...double digest (digesting with two enzymes at the same time), you will need to determine the best buffer...are digesting a large number of plasmids with the same enzyme(s) (for instance, in a diagnostic digest)...

...protocol outlines the seeding of the cells at the same time as the virus-mediated transduction. For some... titer, take the average of multiple dilutions. Sample Data Figure 1: A549 cells were transduced with ...

...complete + 10 µg/mL polybrene. Note, this is just a sample of possible dilutions. You may want to try higher...monoclonal lines from the early polyclonal populations. Sample Data Figure 1: Generation of monoclonal cell lines...

...application Collect and lyse samples to make proteins available. Tissue samples may need additional processing...culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link the samples with formaldehyde...isotype. Overview of application Fix your samples. Prepare your samples using permeabilization, antigen retrieval...Blank controls in the form of sample buffer must also be run. Unique samples (non-biological replicates)...cultured B cells, where each culture should produce the same antibody clone, or from plasmid-based expression...factors, binding partners, location in the cell, and sample processing can hide or reveal epitopes on an antigen...contain antibodies targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally...

...protein, instead of a two-component system (Figure 9C) SAM activators — co-expression of dCas9-VP64 with a modified... ensures that all gRNAs will be expressed in the same cell. This is called multiplexing , and increases...deletions or inversions with two gRNA sites on the same chromosome. Most multiplex systems enable researchers...sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to be efficiently...from Neisseria meningitidis ), which are about the same size as SaCas9, with higher fidelity than SpCas9... types of base edits: Base transitions — edit to same classification of nucleotide base (purine-to-purine...an enzyme evolved to excise inosine to access the same repair pathway and convert A to any other base. ...

...primer is used to amplify a eukaryotic genomic DNA sample. However, a primer should not be too long (> 30...

...just after base 70 there are multiple peaks in the same location. Looking at the trace file will give you...

...have different leader sequences, but operate on the same principle (homologous to the first G on 3'-5' strand...

...centrifuge to separate different components in a liquid sample Using a Light Microscope Learn about the parts ...

... titer, take the average of multiple dilutions. Sample Data Figure 1: 293T cells were transduced with ...

...24–48 h before checking for protein expression. Sample Data Legend: Lenti-X 293T cells were transfected...

... °C as soon as possible to avoid loss of titer. Sample Data Figure 1: 293T cells were transfected with...

... volumes you need to pipet. If you are using the same template DNA for all your reactions, the Template...

...plasmids. Plasmids within a given library have the same backbone, but contain unique inserts. Some libraries...BioRender.com. Both positive and negative screens follow the same basic process. Before applying to cells, the library... screen: Apply library Perform NGS on a control sample (no selection) Apply selection; most cells will...

...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...with gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...

... in a process called transcription. RNA uses the same nucleotide bases as DNA, except thymine is replaced...natural amino acids, so multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer... cells are called clones, since they contain the same genetic information as the parental cell. The plasmid...

... new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant ...Link opens in a new window) Wu, Z., Asokan, A., & Samulski, R. J. (2006). Adeno-associated virus serotypes...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...

... CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV... GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3...

...side of it into any plasmid that has the same sites in the same orientation within its MCS. Due to their...

...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...