We narrowed to 15 results for: sam
-
TypeGuide...arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered α7 nicotinic acetylcholine...varenicline. This PSAM carries mutations at L131G, Q139L, and Y217F and is termed PSAM4 (or PSAM 4 ). Additional...cognate PSEM. For example, PSAM Q79G,Q139G is activated by PSEM 22S , while PSAM L141F,Y115F is activated... effort to develop a PSAM that responded to a clinically approved drug, the PSAM domain was engineered...have also been developed as agonists for PSAM4. A given PSAM is coupled with an ion pore domain (IPD) ...signaling. PSAM-based LGICs can be classified by the ion pore domain they are coupled to: PSAM-Gly LGICs...ions, and inhibits neuronal activity. PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor...
-
Plan Your Experiment
TypeGuide...activator systems exist, including the multi-plasmid SAM system Activate Design and Clone Your gRNA Achieving...the genomic region you intend to target in your samples to ensure there are no discrepancies with the reference... -
Antibody Guide
TypeGuide...application Collect and lyse samples to make proteins available. Tissue samples may need additional processing...culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link the samples with formaldehyde...isotype. Overview of application Fix your samples. Prepare your samples using permeabilization, antigen retrieval...Blank controls in the form of sample buffer must also be run. Unique samples (non-biological replicates)...cultured B cells, where each culture should produce the same antibody clone, or from plasmid-based expression...factors, binding partners, location in the cell, and sample processing can hide or reveal epitopes on an antigen...contain antibodies targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally... -
CRISPR Guide
TypeGuide...protein, instead of a two-component system (Figure 9C) SAM activators — co-expression of dCas9-VP64 with a modified... ensures that all gRNAs will be expressed in the same cell. This is called multiplexing , and increases...deletions or inversions with two gRNA sites on the same chromosome. Most multiplex systems enable researchers...sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to be efficiently...from Neisseria meningitidis ), which are about the same size as SaCas9, with higher fidelity than SpCas9... types of base edits: Base transitions — edit to same classification of nucleotide base (purine-to-purine...an enzyme evolved to excise inosine to access the same repair pathway and convert A to any other base. ... -
Gamma-Retroviral Vector Guide
TypeGuide...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...with gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the... -
Molecular Biology Reference
TypeGuide... in a process called transcription. RNA uses the same nucleotide bases as DNA, except thymine is replaced...natural amino acids, so multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer... cells are called clones, since they contain the same genetic information as the parental cell. The plasmid... -
Adeno-associated virus (AAV) Guide
TypeGuide... new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant ...Link opens in a new window) Wu, Z., Asokan, A., & Samulski, R. J. (2006). Adeno-associated virus serotypes...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the... -
Guide to Using Pooled Libraries
TypeGuide...plasmids. Plasmids within a given library have the same backbone, but they express or target different genes...Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library Apply... -
Sequencing Primers
TypeGuide... CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV... GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3... -
Molecular Cloning Techniques
TypeGuide...side of it into any plasmid that has the same sites in the same orientation within its MCS. Due to their... -
Optogenetics Guide
TypeGuide...make it possible to combine multiple opsins in the same experiment. For example, you could use different...different colors of light to activate/silence the same neuronal population, or activate different neural populations... -
Lentiviral Vector Guide
TypeGuide...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the... -
Science Guides
TypeGuide...plasmids. Plasmids within a given library have the same backbone, but they express or target different genes... -
Modular Cloning Guide
TypeGuide... Mammalian Toolkit Mammalian Expression Hana El-Samad 253 plasmids that allow for the assembly of cellular... -
Adenovirus Guide
TypeGuide...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...