We narrowed to 633 results for: gats

...carefully bring a centrifuge into a cold room for centrifugation. Once you’re done using the centrifuge, bring...

...corresponds completely to the template DNA strand so elongation can proceed. Usually a guanine or cytosine is...

...spreading of antibiotic makes it easy for an investigator to conveniently plate and select transformed...

...of Plasmid DNA Agarose Gel Electrophoresis DNA Ligation Background Information Gel purification allows...

...reagents, determine the amount that you need to weigh. Gather the reagent you will be weighing out, a weighing...

...way to control which orientation the insert is ligated into the vector backbone and therefore the only...

...cells AAV Purification by Iodixanol Gradient Ultracentrifugation Protocol Mulitchannel Pipetting Technique...

... the density of your culture if needed. A good negative control is LB media + antibiotic without any bacteria...

...enzymes, the product of a Gibson Assembly is a fully ligated double-stranded DNA molecule. This has proven to...

... visible in the room and on the door. BSL-2 centrifugation steps require an aerosol-tight lid and rotors...

...plasmid to express the protein of interest, and a negative control sample such as cells that do not express...

... changes to the amount you are dispensing can negatively impact your experimental results. This protocol...

...solution. Pellet the proteins and genomic DNA by centrifugation, and remove the plasmid-containing supernatant...

...Aurnhammer et al., 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-...

... filtration through a 0.45 µm PES filter or centrifugation at >500 x g for 5 minutes. Do not use the medium...

...stained with Trypan Blue. Pellet cell debris by centrifugation at 3900 rpm for 10 min at 4 °C. Transfer the...

...containing only the elements required for bacterial propagation (origin of replication and antibiotic selection...

...-NGG PAM sequences include: xCas9 — NG, GAA, and GAT; increased nuclease fidelity SpCas9-NG — NG; increased...VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA); SaCas9... used for small precision edits. NHEJ directly ligates the break ends without the need for a homologous...system, CRISPRi is introduced into bacteria using conjugation and stably integrated into the chromosome. Browse...CJ) 3' NNNNRYAC Neisseria meningitidis (NM) 3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema...). Unraveling the mechanisms of PAMless DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1)...on the consecutive binding and degradation of negatively supercoiled invader DNA by cascade and CAS3. ...

...components can interfere with the conjugate or conjugation process. Sodium azide, an antimicrobial agent,... back to buffers after the conjugation reaction is complete. HRP-conjugated antibodies should not be stored...done through a conjugation reaction. Many antibodies can be purchased already conjugated, which can save...you want is not available pre-conjugated, or is not available conjugated to your signaling molecule of...indirect detection method uses an unconjugated primary antibody and a conjugated secondary antibody specific...well plate. A conjugated primary antibody is used to bind to the antigen and the conjugate, typically HRP...indirect sandwich method, a conjugated secondary antibody is added. The conjugate is activated and the output...

...end of Gateway cassette Forward GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette Reverse H1 TCGCTATGTGTTCTGGGAAA...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end .../pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MBP-F GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin... OpIE2 Forward CGCAACGATCTGGTAAACAC OpIE2 promoter Forward pACYC-F TGAAGTCAGCCCCATACGAT p15A origin Forward...pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector Reverse pBMN 5' GCTTGGATACACGCCGC MMLV sequence...Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA To sequence...