We narrowed to 609 results for: sam

... in a process called transcription. RNA uses the same nucleotide bases as DNA, except thymine is replaced...natural amino acids, so multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer... cells are called clones, since they contain the same genetic information as the parental cell. The plasmid...

... new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant ...Link opens in a new window) Wu, Z., Asokan, A., & Samulski, R. J. (2006). Adeno-associated virus serotypes...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...

... CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV... GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3...

...side of it into any plasmid that has the same sites in the same orientation within its MCS. Due to their...

...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...

...opsins with different activation wavelengths in the same experiment. For example, you could use different...different colors of light to activate or silence the same neuronal population, or activate different neural populations...

...plasmids. Plasmids within a given library have the same backbone, but they express or target different genes...

... Mammalian Toolkit Mammalian Expression Hana El-Samad 253 plasmids that allow for the assembly of cellular...

...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...