We narrowed to 610 results for: sam
-
TypeGuide... in a process called transcription. RNA uses the same nucleotide bases as DNA, except thymine is replaced...natural amino acids, so multiple codons can encode the same amino acid — a phenomenon called degeneracy. Refer... cells are called clones, since they contain the same genetic information as the parental cell. The plasmid...
-
Adeno-associated virus (AAV) Guide
TypeGuide... new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary recombinant ...Link opens in a new window) Wu, Z., Asokan, A., & Samulski, R. J. (2006). Adeno-associated virus serotypes...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the... -
Guide to Using Pooled Libraries
TypeGuide...plasmids. Plasmids within a given library have the same backbone, but they express or target different genes...Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library Apply... -
Sequencing Primers
TypeGuide... CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV... GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3... -
Molecular Cloning Techniques
TypeGuide...side of it into any plasmid that has the same sites in the same orientation within its MCS. Due to their... -
Optogenetics Guide
TypeGuide...make it possible to combine multiple opsins in the same experiment. For example, you could use different...different colors of light to activate/silence the same neuronal population, or activate different neural populations... -
Lentiviral Vector Guide
TypeGuide...Both lentiviruses and gamma-retroviruses use the same packaging genes. However, they are different viruses...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the... -
Science Guides
TypeGuide...plasmids. Plasmids within a given library have the same backbone, but they express or target different genes... -
Modular Cloning Guide
TypeGuide... Mammalian Toolkit Mammalian Expression Hana El-Samad 253 plasmids that allow for the assembly of cellular... -
Adenovirus Guide
TypeGuide...in cis refers to genetic elements located in the same plasmid as the gene of interest. in trans In the...