We narrowed to 643 results for: ATO
-
TypeGuide...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...Reverse GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC ...forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter GAGCGGATAACAATTTCACACAGG...
-
Lentiviral Vector Guide
TypeGuide...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors...single strand of RNA contains packaging genes, regulatory genes, accessory genes, and the long-terminal...are necessary for lentiviral production in the laboratory, and many have been removed or mutated for increased...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific... genome. To produce lentiviral vectors in the laboratory, the non-required components have been removed... — contains packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids...plasmid — contains entire viral genome (packaging, regulatory, and accessory genes), only envelope removed ... -
Optogenetics Guide
TypeGuide...signals; e.g., calcium indicators In this overview, we will focus on the common actuators used in optogenetics...classified based on their functions into two groups: Actuators are genetically-encoded tools for light-activated...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ...experiment? Depending on your answer, you’d pick an excitatory or inhibitory opsin, respectively. Color of activation...domains bPAC Light-activated adenylyl cyclase from Beggiatoa sp. for light-induced cAMP modulation. Utilizes...plasmids rely on the engineered two-component regulatory system YF1/FixJ. YF1 is a synthetic, photosensitive...chromophore, and phosphorylates the transcriptional activator FixJ in the absence of blue light. 470 Fluorescent... -
Chemogenetics Guide
TypeGuide... Experiment References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ...of ion channels arePharmacologically Selective Actuator Modules (PSAMs, pronounced SAMs). PSAMs are engineered...Depending on your answer, you’d pick a chemogenetic activator or inhibitor, respectively. DREADDs or PSAMs or...delivery. Chemogenetic ligand. The chemogenetic actuator chosen and the context of the experiment will ...such as DCZ versus CNO. Delivery. Chemogenetic actuators are delivered in vivo through viral injection ...Selective Modulation of cAMP Production in Striatopallidal Neurons. Neuropsychopharmacol. 38:854–862. ...Deschloroclozapine, a potent and selective chemogenetic actuator enables rapid neuronal and behavioral modulations... -
DNA Quantification
TypeProtocol... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many... -
Molecular Biology Reference
TypeGuide...can be replicated easily and efficiently in a laboratory setting. Stable - Plasmids are stable long-term... contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter...RNA from the insert DNA via transcription. The terminator sequence on the newly synthesized RNA signals...design a effective primer. Sanger sequencing chromatogram Sanger sequencing is modeled after in vitro ...sequencing results are presented as a sequencing chromatogram which provides the color and intensity of each... -
Weighing Reagents Protocol
TypeProtocol... reagents for a stock mixture is an essential laboratory technique, as imprecise measurements can affect... -
Protocol - How to Inoculate a Bacterial Culture
TypeProtocol...bacterial culture at 37°C for 12-18 hr in a shaking incubator. Note: Some plasmids or strains require growth... -
Gamma-Retroviral Vector Guide
TypeGuide...gamma-retroviral vectors that can be safely used in laboratory settings. These engineered gamma-retroviral vectors...increased safety when producing viral vectors in a laboratory setting. Figure 1: Wild-type gamma-retrovirus... Design. In Retroviruses . Cold Spring Harbor Laboratory Press. NIH Bookshelf De Ravin, S. S., Su, L.,...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes... -
Fluorescence Titering Assay
TypeProtocol...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Inverted... -
General Transfection
TypeProtocol...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents... -
Gibson Assembly Protocol
TypeProtocol...especially useful for introducing promoters, terminators, and other short sequences into the assembly ... -
Lentivirus Production
TypeProtocol...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container pH ... -
Plan Your Experiment
TypeGuide...without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting promoter...promoter elements of target gene Many different activators exist, including the multi-plasmid SAM system. Select...activate or repress a target gene using dCas9-activators or dCas9-repressors, gRNAs should be targeted... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...1000 µL single channel pipette Ice bucket CO 2 incubator Pipet controller Hazardous waste container Reagents... -
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a final Reverse Primer sequence of 5’-... -
Western Blot
TypeProtocol...the Top Stack to one side and discard the white separator. Keep the Bottom Stack in the plastic tray. Place... -
Adenovirus Guide
TypeGuide...diseases in humans and other animals, most commonly respiratory infections, such as the common cold. The immune... express them alongside a guide RNA and other regulatory elements. The packaging capacity of rAdV vectors...such as expressing cytokines and other immune-modulatory molecules. Another strategy has been to use oncolytic... -
Adeno-associated virus (AAV) Guide
TypeGuide... factories for the new viral particles in the laboratory. The cell line used for rAAV vector production...packaging capacity, especially if any additional regulatory elements are needed. One strategy to overcome...Woodchuck hepatitis virus post‐transcriptional regulatory element; stimulates the expression of transgenes... -
AAV ddPCR Titration
TypeProtocol... Transfer the cartridge holder to the droplet generator. Close the lid and wait for the droplets to be...