Skip to main content

We narrowed to 666 results for: CHI;

Showing: 641 - 660 of 666 results
  1. CRISPR Guide

    Type
    Guide
    ...Purify Genomic Regions The enChIP (engineered DNA-binding molecule-mediated ChIP) system, developed by the...the DNA, to create a DSB enChIP En gineered DNA-binding molecule-mediated ChIP , using a tagged-dCas9+gRNA...the ways the CRISPR components are leveraged to achieve specific goals, such as targeting multiple genomic...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...gRNAs into a single plasmid — though some have achieved targeting in the double digits. These multiplex...nickase system is utilized in many CRISPR systems to achieve specific genetic edits. The dCas9 molecule binds...or G, Y = C or T SpRYc — SpRY PAMs plus NNG; a chimeric version of SpRY Though these PAM-flexible Cas9s...
  2. Antibody Guide

    Type
    Guide
    ... Special considerations One type of ChIP assay, called native ChIP, does not use cross-linking and instead...accessible to antibodies. Detection of sdAbs is usually achieved by conjugation of a signaling molecule directly...can be detected either digitally by an imaging machine or by X-ray film. HRP cannot be used to distinguish...detect simultaneously. Conjugation The process of attaching signaling molecules to an antibody is done through...Immunoprecipitation (IP) Chromatin immunoprecipitation (ChIP) Visualization - used to visualize protein location...either X-ray film in a darkroom or an image capture machine. Special considerations The primary antibody must...immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP) allow you to isolate specific proteins or protein...
  3. Optogenetics Guide

    Type
    Guide
    ...Scherffelia dubia 460 C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered chimeras of ChR1 and ChR2; increased...-gated ion channels known as opsins (including chimeric receptors such as OptoXRs) or optical switches...electrical activity in a target cell type. OptoXRs are chimeras of a G-protein coupled receptor (GPCR) and an ...genetic point mutations, codon optimization, and chimeric fusion of domains from two different ChRs. These...signaling networks and other limitations like bleaching. A more selective way to stimulate the activity...activity of a particular GPCR is to engineer a chimeric protein consisting of an opsin and the GPCR of interest...photocurrent amplitude 450–470 C1V1(t/t) ChR1-VChR1 chimera with E122T and E162T mutations; increased photocurrent...
  4. Sequencing Primers

    Type
    Guide
    ...P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG...GCAAATGGCATTCTGACATCC For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with...CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors...GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same as pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3'...
  5. Lentiviral Vector Guide

    Type
    Guide
    ...system. Instead, the transfer plasmid contains a chimeric 5’ LTR fused to a heterologous promoter (often...Transfer plasmid — contains transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and... to predict. In therapeutic applications, like chimeric antigen receptor T cell (CAR-T) therapy, the location...glycoprotein — transduce neural progenitor and stem cells Chimeric envelope genes have also gained popularity to ...accessibility (DIVA) identifies alterations in chromatin architecture through large-scale mapping of lentiviral integration... (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nature Biotechnology...
  6. Modular Cloning Guide

    Type
    Guide
    ...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...be used with plasmids from the MoClo-YTK . MoClo Pichia Toolkit Yeast Expression Volker Sieber Plasmids...assembling large DNA fragments based on methylation-switching. 4G-Cloning Plasmid Kit Bacterial Expression, ...GATEway Cloning Kit Other, Zebrafish Expression Joachim Wittbrodt A toolkit that combines Golden Gate and...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...replication as it activates the necessary cellular machinery to produce large amounts of rAAV vectors. The ... vector depends on the cell’s DNA replication machinery to synthesize the complementary strand, transgene...rAAV capsids. Learn more about optogenetics by watching our Optogenetics 101 video or by visiting Addgene's...Kuleshova, E., Ojala, D., Huang, C. C., Gerfen, C. R., Schiller, J., Dudman, J. T., Hantman, A. W., Looger, L....replication process where the virus uses the cell machinery to produce new viruses, eventually lysing the ...
  8. Molecular Cloning Techniques

    Type
    Guide
    ...Ligation Independent Cloning Yeast-Mediated & Oligo Stitching Resources Molecular cloning, or the creation of...BioRender.com. Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very similar in principle...advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA that share no homology...-mediated plasmid cloning and oligonucleotide stitching. Created with BioRender.com. Additional Resources...
  9. Chemogenetics Guide

    Type
    Guide
    ...Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo expression of chemogenetic receptors. ... our AAV guide . FLEx Vectors are also used to achieve cell-specific expression of AAV-encoded chemogenetic... Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey, B. K., Dannals, R. F., Pomper, ...Carpenter, J. C., Snowball, A., Knauss, S., von Schimmelmann, M., During, M. J., Lignani, G., Schorge, S....
Showing: 641 - 660 of 666 results