Skip to main content
Addgene

We narrowed to 772 results for: LIS;

Showing: 761 - 772 of 772 results
  1. Luciferase Plasmid Collection

    Type
    Collection
    ... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...have been grouped into tables based on the Gene Lists from Immport . Click the links below to go to the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
  3. Antibody Guide

    Type
    Guide
    ...two most common types of ELISAs are direct or sandwich ELISAs. For direct ELISAs, an antigen or protein ...expression and assay efficacy. ELISA Enzyme-linked immunosorbent assay (ELISA) is a plate-based assay that...differentiate between proteins. HRP is also used in ELISAs, which only measure a single antibody signal. Here...relative amounts of protein. Includes: Western blot ELISA Capture - used to isolate specific proteins or protein...Quantification methods, such as western blots or ELISAs, are used to quantify relative amounts of protein...standard curves to quantify exact amounts of proteins. ELISAs quantify a single protein per assay and typically...signaling molecule. Figure 4: A direct sandwich ELISA, which uses a capture antibody and a primary conjugated...
  4. Sequencing Primers

    Type
    Guide
    ...deposited plasmids. Below is a list of commonly used primers. This list is available for your convenience...A list of sequencing primers that Addgene uses for sequence verification of deposited plasmids. Plasmid...Primers Looking for Primers? The primer sequences listed on the left are provided for your reference. Addgene...find your plasmid page and see what primers are listed under "5' sequencing primer" and "3' sequencing...Addgene's Molecular Biology Reference Page . All listed primers are 5′ to 3′. Commonly Used Primers CMV...TAATACGACTCACTATAGGG T7 promoter, forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia...
  5. Molecular Biology Reference

    Type
    Guide
    ...used primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...expression of an endogenous gene. This is frequently accomplished through expression of an shRNA targeting the...edit genomes. Genome editing is most commonly accomplished using CRISPR technology. CRISPR is composed ...-related information and a more extensive strain list. Strain Vendor(s) Genotype BL21 Invitrogen; New ...resistance genes as well as additional antibiotics not listed in the table below can be found in this blog post...Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK ...
  6. Modular Cloning Guide

    Type
    Guide
    ...Yeast Toolkit (MYT) Yeast Expression, CRISPR Tom Ellis 96 plasmids to extend the MoClo-YTK (Dueber) for... Yeast GPCR-sensor Toolkit Yeast Expression Tom Ellis Plasmids for constructing highly-tunable GPCR-based... standards. CyanoGate Kit Bacterial Expression Alistair McCormick Kit containing 96 parts and acceptor...Komagataeibacter Tool Kit (KTK) Bacterial Expression Tom Ellis DNA parts to create multigene constructs expressed...
  7. Optogenetics Guide

    Type
    Guide
    ...relevant variants. This list is not exhaustive - please browse our curated list of opsins here to find ...depression, drug addiction, and more. Below is a list of commonly used microbial opsins, including a brief...Zhang F, Bamberg E, Nagel G, Deisseroth K. 2005. Millisecond-timescale, genetically targeted optical control...
  8. Guide to Using Pooled Libraries

    Type
    Guide
    ...relevant to the phenotype being studied. Examples of published selection mechanisms for lentiviral CRISPR libraries...cells Sequence those cells that pass (“win”) Get a list of genes involved in the selection NEGATIVE screen...between experimental and control cells Generate a list of gRNAs that disappear with addition of the selection...
  9. Educational Resources

    Type
    Guide
    ...using Addgene’s materials, and career advice. Playlists include: Protocols Careers How-to Blog Read about...
  10. Cloning

    Type
    Guide
    ...still be fused together in a seamless manner. To accomplish this, you just need to introduce into the yeast...
  11. Lentiviral Vector Guide

    Type
    Guide
    ...PMID: 36348415 Stewart, S. A., Dykxhoorn, D. M., Palliser, D., Mizuno, H., Yu, E. Y., An, D. S., Sabatini...
Showing: 761 - 772 of 772 results