Skip to main content
Addgene
Showing: 61 - 80 of 1006 results
  1. Lentivirus Plasmids

    Type
    Collection
    ...divided among multiple plasmids. Some plasmids (typically called packaging and envelope plasmids) encode components...the plasmid that encodes the viral genome (typically called the transfer plasmid ). This table lists common...target cells. This genome is encoded by plasmids called "transfer plasmids," which can be modified to encode...
  2. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...to mentors, virtual and local professional development, membership to a local hub of educators teaching...Hypotheses in a Malate Dehydrogenase Oriented CURE. Callahan KP et al. CourseSource. 2022 Jan 14. DOI: 10.24918...Learning Gains and Positive STEM Attitudes in CUREs. Callahan KP et al. CBE Life Sci Educ. 2022 Dec;21(4):ar74...
  3. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...soluble recombinant molecules. The proteins are typically used in systematic protein interaction screens...Extracellular Interaction Screening (AVEXIS) for the scalable detection of low affinity extracellular receptor-ligand...Wright GJ. Genome biology 2009; 10(9):R99. Large-scale screening for novel low-affinity extracellular protein...Sun Y, Gallagher-Jones M, Barker C, Wright GJ. Analytical Biochem. 2012 May 1;424(1):45-53....
  4. Synthetic Biology - Overview

    Type
    Collection
    ...International Genetically Engineered Machine Foundation Registry of Standard Biological Parts - Repository...biology describes the rational engineering of biological systems for novel functions. Addgene is working...BioBricks BioBricks Foundation - Promoting open and ethical synthetic biology JBEI - Joint Bio-Energy Institute...
  5. CRISPR Plasmids - Yeast

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify ...
  6. Qi Lab CRISPR Page

    Type
    Collection
    ...transcription on the gene expression level without genetically altering the target loci. Thus, CRISPRi is a ...Plasmid Description 44246 pdCas9-humanized A catalytically inactive, human codon-optimized Cas9 expression...expression plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion...codon-optimized Cas9 constructs 44249 pdCas9-bacteria A catalytically inactive bacterial Cas9 expression plasmid 44250...
  7. COVID-19 Resources

    Type
    Collection
    ...novel virus strain from the Coronaviridae family called SARS-CoV-2. Scientists have been working at lightning... enzyme that cleaves precursor proteins to a biologically active state. The SARS-CoV-2 S protein contains...Cas13a ( pC013 ) for detection of SARS-CoV-2: A Scalable, Easy-to-Deploy, Protocol for Cas13-Based Detection...Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor . FURIN - Andersen,...
  8. CRISPR References and Information

    Type
    Collection
    ... : John Doench from the Broad Institute gives practical advice for designing your gRNA and introducing... Innovative Genomics Institute, University of California, Berkeley. CRISPR Software Sanger Indel Analysis...stickleback, tobacco, tomato, frog ( X. laevis and X. tropicalis ), and zebrafish. Off-Spotter: tool for CRISPR... mouse, rat, marmoset, pig, chicken, frog (X. tropicalis and X. laevis), zebrafish, sea squirt, Drosophila...
  9. Plan Your Experiment

    Type
    Collection
    ...EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain reporter gene (e.g. ...needs to match the target locus, but it is also critical to ensure that the gRNA target sequence does NOT...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...additional sites throughout the genome. These sites are called off-targets and should be examined during gRNA ...
  10. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...the plasmid that encodes the viral genome (typically called cis -plasmid or transfer plasmid). Helper ...research is that it is replication-limited and typically not known to cause disease in humans. For these... biosafety levels and elicit relatively low immunological effects in vivo . While AAVs can be handled ...
  11. Cell Migration Consortium Plasmids

    Type
    Collection
    ...deposited plasmids include: Joan Brugge , Harvard Medical School Klaus Hahn , UNC Richard Hynes , MIT Rick...University of Virginia Denise Montell , University of California, Santa Barbara Martin Schwartz , Yale University...University of Illinois Ron Vale , University of California, San Francisco Browse Plasmids ID Plasmid Gene...
  12. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Biosensors Optogenetics Background Fluorescent...to use these fluorescent proteins to modulate biological activity. Early tools allow scientists to regulate...transcription factors Connie Cepko See Plasmids Dronpa Optical control of protein activity Michael Lin See Plasmids...
  13. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael Davidson from...the ORFs are of mammalian origin and include localization data found below. In addition, the Davidson ...Expressions website for additional images, tutorials, optical microscopy protocols and resources. Or read our...
  14. Luciferase Plasmid Collection

    Type
    Collection
    ...Resonance Energy Transfer (BRET) CalFlux VNT : An intracellular calcium sensor created by fusing NanoLuc...ability of a given lncRNA to cis-repress Mauro Calabrese 106253 pLS-mP-Luc Firefly Insertion of 5' promoter...Malcolm Moore 51819 Syn-ATP Firefly (modified) CMV Optical reporter of presynaptic ATP Timothy Ryan 24348 ...
  15. AAV Viral Preps

    Type
    Collection
    ...Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1, MaCPNS1...serotypes AAV1, AAV2, AAV5, AAV8, AAV9, AAVrg, the Caltech systemic serotypes, or others, it will be listed...
  16. Plant Plasmids and Resources

    Type
    Collection
    ...repository contains many plasmid tools that were specifically designed for use in plants. These resources ...MoClo Plant Parts II and Infrastructure Kit for hierarchical assembly of plant multigene constructs - Johannes...an Old Favorite External Resources Arabidopsis Biological Resource Center (ABRC) (Link opens in a new window...
  17. Lentiviral Prep Service

    Type
    Collection
    ...libraries to screen for genes involved in specific biological processes. For more information, see our Guide...pooled libraries 92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
  18. Validated gRNA Sequences

    Type
    Collection
    ...GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut...TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...
  19. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...Resources: Empty Backbones Biosensors Subcellular localization Optogenetics Background Förster resonance energy...acceptor molecules and can therefore be used to calculate the distances between the donor and acceptor. ...were developed to be used as FRET standards to calibrate the numerous and disparate methods used to measure...
  20. CRISPR Plasmids - Plants

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...
Showing: 61 - 80 of 1006 results