Skip to main content

We narrowed to 912 results for: IRE

Showing: 61 - 80 of 912 results
  1. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...(loxP) are on the same DNA strand in opposite directions, recombination results in an inversion and the...are on the same DNA strand (in cis) in the same direction, the sequence between the sites is excised as ...evaluating infection/transfection efficiency, selecting desired clones, and making transgenic mice. ID Plasmid ...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...material. The mitochondria produces the energy cells required for chemical reactions. Labeling these structures... H2B mRFP Bryan Welm , Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999... alpha-Tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-Tubulin ...
  3. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). Figure 1: Overview of Cas9 nickase...
  4. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...provides a stark contrast to Cas9 and Cas12, which require that each DNA target have high sequence identity...to limit the spread of infection throughout the entire population. Type VI enzymes that function in mammalian...
  5. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...gRNA and Cas gRNA Only Multiplex Resources CRISPR requires you to express both a Cas protein and a target-specific...not limited to a specific CRISPR function, but require an additional plasmid containing a Cas enzyme or...
  6. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...
  7. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...
  8. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...that utilize Golden Gate cloning to insert the desired guide RNA sequence by digestion of the backbone...Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 ...
  9. TALEN Engineering

    Type
    Collection
    ... engineering TAL effector repeat arrays of any desired length: the REAL (Restriction Enzyme And Ligation...assembly process or lists of plasmid ID numbers required for FLASH assembly. Links to additional pages ...
  10. CRISPR Plasmids - Base Edit

    Type
    Collection
    ... not exist in nature, but have been created by directed evolution of the Escherichia coli TadA, a tRNA...wider editing window, and are thus well suited to directed evolution applications. Examples of these base...
  11. Promega Plasmid Collection

    Type
    Collection
    ...under research use only (RUO) terms and do not require an MTA. Pricing can be found on the individual ...tag enabling precise protein detection. It can be paired with LgBiT for bioluminescent assays or with the...
  12. Sequencing Primers

    Type
    Guide
    ...Forward IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES Forward IRES-R CCTCACATTGCCAAAAGACG 5' end of IRES Reverse... Primers Name Sequence (5' to 3') Description Direction BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone... Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia vectors...
  13. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...genes are not present in the AAV genome, but are required for AAV viral replication. This collection provides... top AAV Helper Plasmids Wild-type AAV viruses require the presence of a "helper" virus, such as adenovirus...
  14. TALEN Plasmids and Kits

    Type
    Collection
    ...higher than the parental vectors. pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter...domains (DD, RR) used are obligate heterodimers that require cloning of left and right TALEN monomer proteins...
  15. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Multiple gRNA plasmids may be used. The HDR (homology directed repair) donor plasmid with homology arms and selection...Rep. 2015 . Alternatively, cDNAs can be cloned directly into this vector and targeted to the AAVS1 genomic...
  16. Zhang Lab CRISPR Page

    Type
    Collection
    ...mutations in p53 and Lkb1 , as well as homology directed repair-mediated Kras G12D mutations, leading to...This plasmid also contains a Kras G12D homology directed repair donor template. #60225 - AAV:ITR-U6-sgRNA...
  17. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...be separated by an internal ribosome entry site (IRES) and expressed under the same promoter. Alternatively...cells - one containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA...response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid), 2) the HIV-1 genome...in terms of RCL generation because this vector requires only three HIV-1 genes (gag, pol, and rev) for...that there is often  background activity and it requires continuous administration of Dox to repress transgene...One drawback of the Tet system is that it often requires the delivery of two distinct expression vectors...This supernatant can be stored at 4 °C or can be directly added to your target cells. However in that case...
  18. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...DreO-bGHpA (50363-AAV5) Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1) Viral...Testing AAV inventory for the entire collection! We are expanding our entire control AAV inventory to give...promoter directs ubiquitous expression. pAAV-mDlx-NLS-mRuby2 (99130-AAVrg): The Dlx element directs expression...in the last few months. You can also browse our entire AAV inventory. Our new AAVs include: EGFP-expressing...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-...112677-AAV5 and 112677-AAVrg): The EF1a promoter directs strong, ubiquitous expression. This is a Cre-dependent...
  19. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ...vectors if you need to. Additionally, they have an IRES-Puro marker to facilitate stable cell clone selection... of dollars, but by approaching it from a new direction, we hope to do it much faster. Years of science...
Showing: 61 - 80 of 912 results