...and constitutively expressing Cas9 knockin mice (Platt et al ., Cell 2014). In these mice the CRISPR-Cas9...luciferase-2A-Cre recombinase, and Kras G12D HDR template 60225 : control for AAV-KPL; sgRNA targeted to...expression vectors for cancer modeling Using Cas9 mice, Platt et al . simultaneously modeled the dynamics of KRAS...contains a Kras G12D homology directed repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-...to enable the rapid ligation of annealed and phosphorylated oligos designed based on the target site sequence...for genome editing in the brain Using Cas9 mice Platt et al. demonstrated in vivo genome editing in the...

...sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting spacer...the Bikard Lab, CRISPR plasmid collection for modulating expression levels of two targets independently...has deposited a collection of CRISPR arrays to modulate the expression levels of two targets independently...sb400021j Figure 1: Multiplexing CRISPR knockdown to modulate expression of two genes without cross‐talk. (A... a single cell, and each color represents the population obtained with one CRISPR plasmid. An overlaid... connects the median values of the different populations. Image and caption from Vigouroux et al., 2018...

...estrogen-related receptor alpha ESRRB Plasmids ESRRB, DFNB35, ERR2, ERRb, ESRL2, NR3B2 estrogen-related receptor...receptors are a class of transcription factors modulated by ligands. Two of the important regions of nuclear...Plasmids ESRRG, ERR3, ERRgamma, NR3B3 estrogen-related receptor gamma HNF4A Plasmids HNF4A, RP5-1013A22.1...MGC119326, MGC119329, RZR-ALPHA, DKFZp686M2414 RAR-related orphan receptor A RORB Plasmids RORB, NR1F2, ROR-BETA...ROR-BETA, RZR-BETA, RZRB, bA133M9.1 RAR-related orphan receptor B RORC Plasmids RORC, RP11-98D18.11-001...001, NR1F3, RORG, RZR-GAMMA, RZRG, TOR RAR-related orphan receptor C RXRA Plasmids RXRA, NR2B1 retinoid...

...advantage of this system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the...Mammalian Green 8405 p240 pPr-CREM/Ins CREM with insulators probasin Mammalian Green 8406 p252 pPr-CREM/CMV-STOP-luc... CREM and CMV-STOP-luc cassette, separated by insulator probasin Mammalian Green 11543 pPGK-Cre-bpA Cre... metallothionein MT-I region including the polyadenylation site and several introns tet-hCMV Mammalian...floxed) Constructs These constructs allow for Cre-regulated gene expression. Depending on the construct, Cre...Genes A and B. When Cre is absent, only Gene A is translated correctly. Cre expression excises Gene A and ...and alters the reading frame to allow in-frame translation of Gene B. FLEx Switch ∗ : This system allows...

...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31 rice snoRNA...

...enChIP-MS - A putative role of HDX as a negative regulator. Hamidian A, Vaapil M, von Stedingk K, Fujita ...ChIP combined with NGS analysis reveals genomic regulatory regions that physically interact with the Pax5...srep30485. PubMed . Efficient sequence-specific isolation of DNA fragments and chromatin by in vitro enChIP....0116579. eCollection 2015. PubMed . Efficient isolation of specific genomic regions retaining molecular...10.1371/journal.pone.0103084. PubMed . Efficient isolation of specific genomic regions and identification.../srep03171. PubMed . Direct identification of insulator components by insertional chromatin immunoprecipitation...Insertional chromatin immunoprecipitation: a method for isolating specific genomic regions. Hoshino A, Fujii H. ...

...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ... for genetic screening experiments, due to the relative ease of designing gRNAs and the ability to modify...are treated with the pooled library to create a population of mutant cells that are then screened for a ...3rd 10 187,535 Advanced Catalogue of Epigenetic Regulators (ACER) 226117 Knockout Human Lu 3rd 10 8,205 ...3rd 4 2,852 Bonifacino Lab Human ubiquitination-related proteins CRISPR KO library 174592 Knockout Human...Knockout Mouse Tolar 3rd ~4 78,637 Mouse Chromatin Regulator Library 200011 Knockout Mouse Griffin, Manguso...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...

...multiple cell types, but are typically limited to related cell lineages. Pluripotent embryonic and multipotent...technology removes the possible ethical concerns related to embryonic stem cell use and has the major advantage...to generate iPSCs. The generation of iPSCs is relatively simple in concept: ectopically express a cocktail...BRD3R promotes human nuclear reprogramming and regulates mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa...polycistronic cassettes KLF4 N-terminal variance modulates induced reprogramming to pluripotency. Stem Cell...from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci... conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Stem Cell Reports...

...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...

...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...eYFP E2 regulatory element Activator C1V1 Dimidschstein 135634 pAAV-S5E2-ChR2-mCherry E2 regulatory element...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image courtesy...DREADD Roth 135635 pAAV-S5E2-Gq-P2A-dTomato E2 regulatory element Activator DREADD Dimidschstein Biosensors...GCaMP Kim , GENIE 135632 pAAV-S5E2-GCaMP6f E2 regulatory element Calcium sensor GCaMP Dimidschstein 100854...

...Overview of TALEN Technology Imagine being able to manipulate a specific region of DNA in the genome of your...species almost as easily as correcting a typo in the latest draft of your dissertation. Well, that will probably...recognition code of the TAL effectors, which were isolated from the plant bacterial pathogen Xanthomonas....bind adenenine with lower specificity). With the template for studying this type of technology already laid...Intuitively, one would expect that assembling relatively small, repeat-laden DNA regions into a single...construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol. 2011...

...Find CRISPR plasmids to study the regulatory networks involved in retinal development....Collection The Brzezinski lab investigates gene regulation in the context of the developing mouse retina...retina. To aide in their studies of the regulatory networks involved in retinal development the lab utilizes...plasmid to expand its usefulness for the lab's gene regulation and developmental studies. Key plasmid features...followed by a quick ligation of annealed and phosphorylated oligonucleotides containing the guide target...

...Scanziani Tools for Cell Ablation These AAV encode tools that can be used for cell ablation. ID Name Expression...Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators and Inducible Tools... toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp...designer pro-taCasp3 and TEVp for studying cell ablation. 5 Shah , Wells Don’t See What You’re Looking ...

...protein translation machinery. To expand the genetic code, 4 major changes to the standard translation machinery...Accessible Using Phosphoserine to Study Protein Phosphorylation Rinehart Lab reagents tRNA/Synthetase Pairs...acids. Expanding the Genetic Code In protein translation, an aminoacyl-tRNA synthetase (aaRS) loads its...binding protein to a DNA cleaving enzyme) or to regulate the activity of a protein so that it is responsive... for another. The orthogonal synthetase must aminoacylate only the orthogonal tRNA, and not endogenous...endogenous ones. Endogenous synthetases cannot aminoacylate the orthogonal tRNA. And the orthogonal tRNA has to...

...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ...

...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...

...and GEF Plasmids The ARF (ADP-ribosylation factor) family of regulatory GTPases have long been characterized...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs. Plasmid...26893300 ). Though best known for their roles as regulators of membrane traffic, they also play critical ... and mitochondria. The activity of GTPases is regulated both upstream (by GEFs, guanine nucleotide exchange...

...researchers also use bacteria like E. coli and their relatively well understood biology to answer many interesting...and mutations to the bacterial genome itself. Manipulating the genome directly can give you more subtle...interest in bacteria, add epitope tags to it, and, later, cleave those tags from the purified protein. Protein... combinations of constituitive promoters and translation initiation elements that can be used to drive...researcher Growth of strain USO hisB- pyrF- rpoZ- on plates lacking histidine and containing 3-AT Scot Wolfe...USO hisB- pyrF- rpoZ- , this promotes growth on plates lacking His and containing 3-AT. FLIParaF.Ec-250n...

...TAL Effector Kit 2.0. Stephen Ekker Platinum Gate TALEN Kit Platinum TALENs assembled by Golden Gate. Validated... and showed robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors... the amount of Histone H3 lysine 4 (H3K4) di-methylation at the target locus ( Mendenhall et al., 2013...This epigenome editing was also shown to alter regulation of nearby gene expression. The vectors listed...

...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...101 post for more information about HDR/repair template design. How to use CRISPR to tag your gene of ... (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This vector serves...encodes both a guide RNA transcript and a repair template for an individual tagging event. The kit contains...plasmids in the following articles provide PCR templates for amplification of the tag (eg GFP, Flag, YFP...