Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 149 results for: LYC

Showing: 61 - 80 of 149 results

  1. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...EAAC1 Rat Mouse IgG2a 206573 Anti-Glycine receptor Alpha3 [N424/45R] Glycine receptor Alpha3 Human Mouse IgG2a... IgG2a 206574 Anti-Glycine receptor Alpha3L [N424/48R] Glycine receptor Alpha3L Human Mouse IgG2a 206575...receptor Mouse Mouse 206774 Glycine receptor Alpha3 scFv [N424/45] N424/45 scFv Glycine receptor Alpha3 Human...

  2. mTOR Pathway

    Type
    Collection
    ...synthesis, and increases energy production through glycolysis to fuel these energy-intensive processes. mTORC1...associated protein; LST8 homolog GSK3 GSK3A GSK3B Glycogen synthase kinase 3 MDM2 MDM2 proto-oncogene mSin1...

  3. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...acceptable. The bulk sorted cells are composed of a polyclonal population exposed to sgRNA-A and sgRNA-B (see...a single reaction. Optimize multiplexing in a polyclonal population ( i.e., bulk sorted cells) before ...

  4. Validated gRNA Sequences

    Type
    Collection
    ...70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286...

  14. Hot Plasmids - January 2023

    Type
    Blog Post
    ...amplify your signal - giving you the benefit of a polyclonal, with the reproducibility of a (recombinant) ...

  19. Hot Plasmids - February 2022

    Type
    Blog Post
    ...individually (~20,000 lanes/50 mLs) or through two polycistronic expression vectors (3570 lanes/50 mLs) coexpressing...
Showing: 61 - 80 of 149 results