We narrowed to 146 results for: LYC
-
TypeBlog Post...terminators can be used to precisely tune your polycistronic E. coli expression constructs. Some applications...and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal...
-
Viral Vectors 101: AAV Serotypes and Tissue Tropism
TypeBlog Post...receptor (AAVR)2 AAV2 Heparan sulfate proteoglycan (HSPG)3 AAV receptor (AAVR; not strictly required.../α2,6 N-linked sialic acids1 Heparan sulfate proteoglycan (HSPG)3 AAV receptor (AAVR)2 Epidermal growth... -
Technique: Probe Phage Genomes for Host Binding Proteins
TypeBlog Post...frequently alter their DNA by adding methyl groups, glycosyl groups, and other modifications to their bases... the interactions between bacteriophage-encoded glycan binding proteins and carbohydrates." Current opinion... -
Validated gRNA Sequences
TypeCollection...70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286... -
Genetic Code Expansion
TypeCollection...) 7-HCou Aminoacyl (7-hydroxy-4-coumarin-yl) ethylglycine Bacterial TAG Kenneth Johnson 198323 pRSF-G1TMSNKRS...CouRS M. jannaschii (7-hydroxy-4-coumarin-yl) ethylglycine (Hco) Bacterial TAG Thomas Huber 231129 pBK-... -
Institute for Protein Innovation
TypeCollection... Glypicans are a family of highly conserved proteoglycans crucial for regulating cell signaling during... -
CRISPR Plasmids - Base Edit
TypeCollection...that increase product purity such as the DNA glycosylase inhibitor (UGI) or the bacteriophage Mu- derived... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...virus particles with the SARS-CoV-2 spike (S) glycoprotein on the envelope surface. Pseudotyped virus particles... -
Easing the Protein Purification Process with pCri
TypeBlog Post...In addition, P. pastoris has the capacity to glycosylate proteins and may recapitulate the post-translational... -
AAV for Neuronal Tracing
TypeCollection...For example, G-deleted rabies lacks the viral glycoprotein (G) gene, which is not required for the transcription... -
Early Career Researcher Toolbox: Free Online Molecular Biology Tools
TypeBlog Post... resuspension calculator (sign-in required.) DailyCalcs Science Calculator app for iPhone Reagent and... -
What's the Best Way to Elute and Store Your Plasmid DNA?
TypeBlog Post...depurination. In depurination, the hydrolysis of the glycosidic bond leads to the release of a purine (adenine... -
Antibodies 101: Chimeric Antibodies
TypeBlog Post...blog Antibodies 101: Validation Antibodies 101: Polyclonal Antibodies Antibodies 101: Selecting the Right... -
Addgene Begins Distribution of Recombinant Antibodies
TypeBlog Post...hybridomas’ genomic drift or limited material from polyclonal animal preparations (Bradbury et al., 2015). ... -
Three Tips for Preventing Viral Plasmid Recombination in Your Samples
TypeBlog Post...backbone. Test multiple colonies before saving a glycerol stock to ensure the colony you selected contains... -
Behind-the-scenes of the Isolation of the Thermostable IgnaviCas9 From a Yellowstone Hot Spring
TypeBlog Post...sediment samples, stabilizing them in ethanol and/or glycerol, since there are no universal conditions for culturing... -
Fluorescent Biosensors for Measuring Autophagic Flux
TypeBlog Post...can not be conjugated to PE due to a C-terminal glycine deletion, so it remains in the cytosol acting as... -
Why Add Sucrose? Improved Yields for Adeno-associated Virus Preparation
TypeBlog Post...viral particle’s affinity for heparan sulfate proteoglycans on the surface of the packaging cells (Vandenberghe... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...nucleoids 164499 EZH2-mEGFP AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP... -
Hot Plasmids - January 2023
TypeBlog Post...amplify your signal - giving you the benefit of a polyclonal, with the reproducibility of a (recombinant) ...