Skip to main content

We narrowed to 1,052 results for: STI;

Showing: 61 - 80 of 1052 results
  1. Optogenetics AAV Preps

    Type
    Collection
    ...Venus Constitutive 1, 9 Karel Svoboda 58892 pAAV-GFAP104-ChR2-mCherry GFAP ChR2 mCherry Constitutive 5 Edward...mScarlet Constitutive 9 Christopher Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, ...ChETA EYFP Constitutive 9 Karl Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 EYFP Constitutive 1, 5, 9, ...mCherry Constitutive 8 Roger Tsien 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5...EYFP Constitutive 2, 5 Karl Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive 8 Karl...dependent Flp dependent Cre and Flp dependent Constitutive Serotype AAV1 AAV2 AAV5 AAV8 AAV9 AAVrg PHPeB...pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Gordon Fishell 135634 pAAV-S5E2-ChR2...
  2. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...titers were similar to those reported by these institutions. This protocol is for a 96-well plate with 20...reaction volume. Last Update: February 13, 2019 Estimate of time required: ~3 h Workflow Timeline Plate...
  3. AAV ddPCR Titration

    Type
    Protocol
    ...ensure that you are in compliance with your institution’s biosafety regulations. Equipment Class II, Type... When analyzing data there should be a clear distinction between negative droplets (black) and positive...
  4. Kit Free RNA Extraction

    Type
    Protocol
    ...entire tube is dried but while the white pellet is still visible. Resuspend RNA pellet in RNase-free water...
  5. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...a biosensor in a novel context or modifying an existing construct, as fluorescence properties can be affected...Fast Genetically Encoded Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded...High-performance GFP-based calcium indicators (Constitutive or Cre-dependent) High-performance calcium sensors...calcium sensors for imaging neural activity (Constitutive or Cre-dependent) Ultrasensitive fluorescent...regulatory element Viral manipulation of functionally distinct interneurons in mice, non-human primates and humans...Yellow protein calcium sensor jYCaMP1 variants (Constitutive or Cre-dependent) jYCaMP: an optimized calcium...
  6. TALEN Plasmids and Kits

    Type
    Collection
    ...pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination constructs were designed...TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-ELD-Destination Golden Gate TALEN 2.0...pC-GoldyTALEN and RCIsricpt-GoldyTALEN are designed as destination vectors for the Voytas lab Golden Gate TALEN ...-BB and pTAL6-BB are designed as alternative destination vectors for the Golden Gate TALEN kit (Bogdanove... pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs built into this vector....several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available with homodimeric or enhanced...accessory pack contains modified pFUS array vectors, destination vectors and a reporter vector for mammalian cell-based...
  7. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...p15TV-L EF456736 Hexahistidine tag with TEV cleavage, AmpR 26093 pET15-MHL EF456738 Hexahistidine tag with TEV...GST-tag and hexahistidine tag with Thrombin cleavage, KanR 26096 pET28-MHL EF456735 Hexahistidine tag with...26117 pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106 Hexahistidine tag with TEV cleavage...EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-TrxT GU269914 Hexahistidine tag, thioredoxin...GU452710 Hexahistidine tag , Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with...TEV cleavage, AmpR 26094 pET28a-LIC EF442785 Hexahistidine tag with Thrombin cleavage, KanR 26101 pET28GST-LIC...ptac promoter, AmpR 26099 pFBOH-LIC EF456740 Hexahistidine tag with Thrombin cleavage, Bac-to-Bac Baculovirus...
  8. AAV Molecular Tools

    Type
    Collection
    ...Activity Serotype PI 99118 pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA...34910 paavCAG-pre-mGRASP-mCerulean CAG-driven, constitutive Expression of pre-synaptic mGRASP-mCerulean ...34912 paavCAG-post-mGRASP-2A-dTomato CAG-driven, constitutive Expression of post-synaptic mGRASP-dTomato for...AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of human codon-optimized Cas9 from...Feng Zhang 85450 pAAV-RSV-SpCas9 RSV-driven, constitutive Expression of SpCas9. 8 Hetian Lei 104588 pAAV-EFS-SpCas9...pAAV-EFS-SpCas9 EFS-driven, constitutive Expression of Myc-tagged SpCas9. 8 Ryohei Yasuda Labeling Tools...Serotype PI 149415 pAAV-TBG-ER-TurboID TBG-driven, constitutive Expression of ER-localized TurboID (with HA ...
  9. Modular Cloning Guide

    Type
    Guide
    ...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...Expression Paul Freemont 78 plasmids including constitutive promoters, T7 expression, RBS strength variants...nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use in E. coli for a variety of applications...Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms...Takashi Yamamoto Nine pFUS array vectors and destination vectors designed for use with the Golden Gate...
  10. NETRF

    Type
    Collection
    ...NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution NETRF Project...Meyerson Dana-Farber Cancer Institute Finding the Causes of Small Intestinal Neuroendocrine Tumors Ramesh...Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid...Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Bradley Bernstein Broad Institute Identifying...Project Title Hans Clevers Hubrecht Institute Modeling Neuroendocrine Tumors Using Adult Stem Cell-Derived...Identifying Altered Epigenetic States and Drivers in Intestinal Carcinoid and Pancreatic Neuroendocrine Tumors...
  11. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC20661 CSF1 colony stimulating factor 1 (macrophage) MCSF, MGC31930 CSF1R colony stimulating factor 1 receptor...CSF3 colony stimulating factor 3 (granulocyte) G-CSF, GCSF, MGC45931 CSF3R colony stimulating factor 3 receptor...LXA4R FSHB follicle stimulating hormone, beta polypeptide - FSHR follicle stimulating hormone receptor FSHRO...PTP, REG RETN resistin ADSF, FIZZ3, MGC126603, MGC126609, RETN1, RSTN, XCP1 RETNLB resistin like beta FIZZ1...MGC141920 TSHB thyroid stimulating hormone, beta CHNG4, TSH-BETA TSHR thyroid stimulating hormone receptor ...inducible - VIP vasoactive intestinal peptide MGC13587, PHM27 VIPR1 vasoactive intestinal peptide receptor 1 ...presenting its cognate antigen along with co-stimulation activates the T cell, whereas T cell tolerance...
  12. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...page Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination vectors - Inducible expression...vector for ORF expression pDest-565 - Gateway destination vector for bacterial expression; His,GST tag ...N-terminal GST pGCS-N5(GST) - GST tagged Gateway destination vector for mammalian, avian, xenopus, or zebrafish...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo ...Zeo DEST - Tet-inducible lentiviral Gateway destination vector for gene expression Lentiviral backbones ...Basic Vector - Firefly luciferase vector for investigating regions controlling transcription See our Luciferase...for cloning in shRNAs, including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression...
  13. Antibody Guide

    Type
    Collection
    ...fluorophores to distinguish between cells. Most flow experiments will use one marker to distinguish between live... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...measurable light or color in response to a specific stimulus, can be conjugated to antibodies in order to allow...machine or by X-ray film. HRP cannot be used to distinguish between different antibodies in the same reaction...the number of signaling molecules that can be distinguished in your application. The indirect detection ...molecule to epitope ratio. Secondary antibodies can distinguish between different species of origin, isotypes...between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This...
  14. Bacterial Expression Systems

    Type
    Collection
    ...bacteria as model systems to answer many interesting biological questions. Escherichia coli is the most widely...gram-positive bacteria, are also being used for their distinct features. Addgene distributes many plasmids that... Expression It isn’t always advantageous to constitutively express your gene of interest at high levels...36267 pBAD33.1 pBAD Arabinose Escherichia coli Christian Raetz 26098 pCW-LIC 3xPtac Lactose/IPTG Escherichia...106476 pET28a_T5-ARG1 Bacterial cells Ultrasound (acoustic reporter gene, ARG1) Escherichia coli Nissle 1917...106473 pET28a_T7-ARG1 Bacterial cells Ultrasound (acoustic reporter gene, ARG1) Escherichia coli Mikhail ...106474 pET28a_T7-ARG2 Bacterial cells Ultrasound (acoustic reporter gene, ARG2) Escherichia coli Mikhail ...
  15. Tetracycline Inducible Expression

    Type
    Collection
    ...CRISPRa Emma Rawlins 72835 pMK243 (Tet-OsTIR1-PURO) Expresses OsTIR1 under the control of a TRE3GS promoter...repurposing endogenous systems that respond to natural stimuli like hormones or metal ions, scientists have adapted... puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection. ...Tet-Off vector for repressible expression with blasticidin selection. *Note: this vector contains an insert...Blast (w756-1) Lentiviral Tet-On vector with blasticidin selection. See Plasmid #26730 for hygromycin ...selection. rtTA3 Eric Campeau 128061 pLVX-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On... vector expressing Tet-On 3G transactivator constitutively expressed by EF1a promoter Tet-On 3G rtTA David...
  16. Sequencing Primers

    Type
    Guide
    ...’s protocol to design your own primers . Still have questions about choosing the best primer for your ...EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG...TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA...
  17. Plan Your Experiment

    Type
    Collection
    ...have a biological question in mind. Then you can decide how to answer that question using genetic manipulation...efficiency. So while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA...your specific application. Knockout : Target constitutively expressed regions, 5’ exons, or an exon known...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...choosing a validation method, ask yourself some questions: Does the resulting population need to be identical... insertions/deletions Very inefficient Can't distinguish specific edits PCR Knockouts Large insertions...Insertions/deletions Prime and base edits HDR Can distinguish between homozygous and heterozygous edits High...
  18. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ... Standards SynBio Blog Genome Engineering A distinguishing feature of synthetic biology is the ease with...ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG or TACTAG Features: 8 bp Scar; No...Prohibited Restriction Sites: EcoRI, XbaI, SpeI, PstI Restriction Sites to Avoid: NotI For more info, ...GCTAGC GCGGCCG CTGCAG Suffix Enzymes: Nhel , NotI , PstI Scar: GCTAGT Features: 6 bp scar encodes Ala-Ser...Prohibited Restriction Sites: EcoRI, SpeI, NheI, PstI Restriction Sites to Avoid: PvuII, XhoI, AvrII, ...ACTAGT A GCGGCCG CTGCAG Suffix Enzymes: SpeI , NotI , PstI Scar: ACTAGA Features: Modified RFC 10 with shortened...Prohibited Restriction Sites: EcoRI, XbaI, SpeI, PstI For more info, visit iGEM: Silver Standard (RFC ...
  19. Ras Pathway

    Type
    Collection
    ... the Ras pathway. Ras is a small GTPase and constitutively active Ras is the most common oncogene in human... occur in the Ras gene it can be stuck in a constitutively active form, constantly activating pathways...cell growth and potentially leading to cancer. Constitutively active Ras is the most common oncogene in human...v-akt murine thymoma viral oncogene homolog 3 ALK Anaplastic lymphoma receptor tyrosine kinase ARHGAP35 Rho...MLST8 MTOR associated protein, LST8 homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide.... The RAS Initiative - at the National Cancer Institute (NCI) References Ras oncogenes and their downstream...
Showing: 61 - 80 of 1052 results