Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 81 results for: actin

Clear keywords
Showing: 61 - 80 of 81 results

  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Friedreich ataxia Michael Ristow 14994 pDRIVE-CAG-hFX-HA FXN HA, AU1 CAG Friedreich ataxia Michael Ristow 15239...wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 NOTAG1 TARDBP CAG ALS Zuoshang Xu 28207 TDP43...TDP43 NOTAG2 TARDBP CAG ALS Zuoshang Xu 28208 TDP43 NOTAG3 TARDBP CAG ALS Zuoshang Xu 28209 TDP43 NOTAG6...NOTAG6 TARDBP CAG ALS Zuoshang Xu 28210 TDP43 NOTAG11 TARDBP CAG ALS Zuoshang Xu 29340 pcDNA3.1/GS-DJ1-R98Q-V5...30137 pCAX APP 695 APP CAG Alzheimer's Dennis Selkoe 30138 pCAX APP 751 APP CAG Alzheimer's Dennis Selkoe...pCAX APP delta CT APP CAG Alzheimer's Dennis Selkoe 30144 pCAX APP AENATA APP CAG Alzheimer's Dennis Selkoe...30145 pCAX APP Swe/Ind APP CAG Alzheimer's Dennis Selkoe 30146 pCAX APP C99 APP CAG Alzheimer's Dennis Selkoe...

  2. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...pcDNA3.1-mGreenLantern - Mammalian Expression pAAV-CAG-mGreenLantern - Mammalian AAV Expression pBAD-mGreenLantern...Expression E2-Crimson 611 646 29 4.5 24 min Tetramer pAAV-CAG-E2-Crimson - Mammalian AAV Expression pEB2-E2-Crimson...Monomer pmiRFP680-N1 - Mammalian Expression pAAV-CAG-miRFP680 - Mammalian AAV Expression pDRF1 ymiRFP680...Bacterial Expression miRFP713 690 713 7 3.5 Monomer pAAV-CAG-miRFP713 - Mammalian AAV Expression pmiRFP713-N1 ...Monomer pmiRFP720-N1 - Mammalian Expression pAAV-CAG-miRFP720 - Mammalian AAV Expression Return to top...

  3. Viral Production

    Type
    Collection
    ...AAVrg) alone at 1.7E6 viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) ...Deisseroth (Addgene viral prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward...

  4. Promoters

    Type
    Guide
    ...Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory...Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; contains...CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter...

  5. TALEN Plasmids and Kits

    Type
    Collection
    .... TALEN expression is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis ...for blue/white-screening in E.coli , (iii) CAG promoter and Kozak sequence to drive efficient TALEN expression...

  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...PV2509 29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-...Huebener, Tobias Rose AV-1-68717 68717-AAV1 pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Biosensor Tobias...Huebener, Tobias Rose AV-1-68719 68719-AAV1 pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA Biosensor Tobias...pENN.AAV.CAG.tdTomato.WPRE.SV40 James M. Wilson AV-1-PV2509 29777-AAV1 pAAV-CAG-ArchT-GFP Ed Boyden AV-1-PV2055 105546-AAV1 pENN....

  7. Tetracycline Inducible Expression

    Type
    Collection
    ...Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off vector, expresses tTA from the CAG promoter. See article ( Chan...pCAG-tTA Mammalian expression of tTA from the CAG promoter for Tet-Off tTA-Advanced Takeshi Imai 104109 pAAV-Syn1...

  9. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...and pX458 modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter ...

  10. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page offers...mice. The Jacks Lab used this backbone to target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus...

  11. E11 Bio PRISM Collection

    Type
    Collection
    ...the barcode proteins under the constitutive CAG promoter (Addgene #242764–242781), but E11 Bio has also...

  12. Technical Design of a Western Blot

    Type
    Blog Post
    ...expressed “housekeeping” proteins — like GAPDH or actin — are often used, it is far more accurate to use...

  13. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...AAV-PHP.eB, when paired with the ubiquitous CAG promoter, is relatively biased toward L5 and inhibitory...quite pronounced, even when using a ubiquitous CAG promoter. Spatial transcriptomics shows that its tropism...

  15. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...as mitochondria, as well as macromolecules like actin and myosin, and enzymes for transmitter synthesis...

  17. Sequencing Primers

    Type
    Guide
    ...promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...

  19. Chemogenetics Guide

    Type
    Guide
    ... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted Expression Depending ...
Showing: 61 - 80 of 81 results