We narrowed to 975 results for: lat
-
TypeCollection...They are frequently used in molecular biology to isolate, multiply, or express the insert they carry in ...Viral Vector Delivery, Genome Modification, mRNA Regulation, and More Selectable Markers Species-Specific...This means that the final product should be translated as a single string of amino acids that preserves...3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation for mammalian expression pDest-527 - N-terminal... pDest vector that adds an N-terminal myristoylation signal GST Protein purification...information Genome Modifications, Reporter Assays, mRNA Regulation, and More Find empty backbones for other uses...plasmid backbones into which you can clone your regulatory element or gene of interest to create a luciferase...
-
CRISPR Plasmids - Plants
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid...none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31 rice snoRNA... -
CRISPR Pooled gRNA Libraries
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ... for genetic screening experiments, due to the relative ease of designing gRNAs and the ability to modify...are treated with the pooled library to create a population of mutant cells that are then screened for a ...3rd 10 187,535 Advanced Catalogue of Epigenetic Regulators (ACER) 226117 Knockout Human Lu 3rd 10 8,205 ...3rd 4 2,852 Bonifacino Lab Human ubiquitination-related proteins CRISPR KO library 174592 Knockout Human...Knockout Mouse Tolar 3rd ~4 78,637 Mouse Chromatin Regulator Library 200011 Knockout Mouse Griffin, Manguso...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ... -
Plasmids for Stem Cell Research
TypeCollection...multiple cell types, but are typically limited to related cell lineages. Pluripotent embryonic and multipotent...technology removes the possible ethical concerns related to embryonic stem cell use and has the major advantage...to generate iPSCs. The generation of iPSCs is relatively simple in concept: ectopically express a cocktail...BRD3R promotes human nuclear reprogramming and regulates mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa...polycistronic cassettes KLF4 N-terminal variance modulates induced reprogramming to pluripotency. Stem Cell...from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci... conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Stem Cell Reports... -
CRISPR Plasmids - Drosophila
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid... -
Luciferase Plasmid Collection
TypeCollection...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...backbone plasmids into which you can clone your regulatory element or gene of interest into to create a ...Reporter Constructs Already know what gene or regulatory element that you need a luciferase reporter for...search box to find a construct that contains your regulatory element of interest. ID Plasmid Description Gene... to study processes beyond transcription and translation. Splicing reporters from Younis et al., 2010 ...Optimized STARR-seq (Self-Transcribing Active Regulatory Region) : Genome-wide screening of enhancers ... -
Caltech Systemic Capsids
TypeCollection...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...eYFP E2 regulatory element Activator C1V1 Dimidschstein 135634 pAAV-S5E2-ChR2-mCherry E2 regulatory element...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image courtesy...DREADD Roth 135635 pAAV-S5E2-Gq-P2A-dTomato E2 regulatory element Activator DREADD Dimidschstein Biosensors...GCaMP Kim , GENIE 135632 pAAV-S5E2-GCaMP6f E2 regulatory element Calcium sensor GCaMP Dimidschstein 100854... -
TALEN Guide
TypeCollection...Overview of TALEN Technology Imagine being able to manipulate a specific region of DNA in the genome of your...species almost as easily as correcting a typo in the latest draft of your dissertation. Well, that will probably...recognition code of the TAL effectors, which were isolated from the plant bacterial pathogen Xanthomonas....bind adenenine with lower specificity). With the template for studying this type of technology already laid...Intuitively, one would expect that assembling relatively small, repeat-laden DNA regions into a single...construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol. 2011... -
Brzezinski Lab CRISPR Collection
TypeCollection...Find CRISPR plasmids to study the regulatory networks involved in retinal development....Collection The Brzezinski lab investigates gene regulation in the context of the developing mouse retina...retina. To aide in their studies of the regulatory networks involved in retinal development the lab utilizes...plasmid to expand its usefulness for the lab's gene regulation and developmental studies. Key plasmid features...followed by a quick ligation of annealed and phosphorylated oligonucleotides containing the guide target... -
Genetic Code Expansion
TypeCollection...protein translation machinery. To expand the genetic code, 4 major changes to the standard translation machinery...Accessible Using Phosphoserine to Study Protein Phosphorylation Rinehart Lab reagents tRNA/Synthetase Pairs...acids. Expanding the Genetic Code In protein translation, an aminoacyl-tRNA synthetase (aaRS) loads its...binding protein to a DNA cleaving enzyme) or to regulate the activity of a protein so that it is responsive... for another. The orthogonal synthetase must aminoacylate only the orthogonal tRNA, and not endogenous...endogenous ones. Endogenous synthetases cannot aminoacylate the orthogonal tRNA. And the orthogonal tRNA has to... -
Validated gRNA Sequences
TypeCollection...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ... -
CRISPR Plasmids - Yeast
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid... -
AAV Molecular Tools
TypeCollection...Kim Tools for Cell Ablation These AAV encode tools that can be used for cell ablation. ID Name Expression...Transactivators Affinity Purification Neurophysiology Cell Ablation Genome Engineering Labeling Overexpression Tetracycline... toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp...designer pro-taCasp3 and TEVp for studying cell ablation. 1, 5 Shah , Wells Genome Engineering Tools These... -
Arf GTPase Family
TypeCollection...Plasmids References The ARF (ADP-ribosylation factor) family of regulatory GTPases have long been characterized...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs. Plasmid..., 2016). Though best known for their roles as regulators of membrane traffic, they also play critical ... and mitochondria. The activity of GTPases is regulated both upstream (by GEFs, guanine nucleotide exchange... -
TALEN Plasmids and Kits
TypeCollection...TAL Effector Kit 2.0. Stephen Ekker Platinum Gate TALEN Kit Platinum TALENs assembled by Golden Gate. Validated... and showed robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors... the amount of Histone H3 lysine 4 (H3K4) di-methylation at the target locus ( Mendenhall et al., 2013...This epigenome editing was also shown to alter regulation of nearby gene expression. The vectors listed... -
CRISPR Plasmids - Tagging
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...101 post for more information about HDR/repair template design. How to use CRISPR to tag your gene of ... (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This vector serves...encodes both a guide RNA transcript and a repair template for an individual tagging event. The kit contains...plasmids in the following articles provide PCR templates for amplification of the tag (eg GFP, Flag, YFP... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667 Mammalian U6 yes, methylation S. pyogenes...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...S. pyogenes Kamoun pUC119-gRNA 52255 Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI...pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S. pyogenes Puro Zoldos pBLO1811_Cas9_noNLS_human...multiplexed plant genome editing and transcriptional regulation Plant Three types of plasmids available for use... -
CRISPR Plasmids - Parasites
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ... these parasites. Moreover, CRISPR-dCas9 gene regulation has also been established for some of these parasites...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed... -
CRISPR Plasmids - C. elegans
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid... -
CRISPR Plasmids - Prime Edit
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...binding site (PBS) and the desired edits on an RT template. During prime editing, the pegRNA directs the ...transcriptase. Engineering of the PE enzyme and related components have helped to improve the efficiency...the reverse transcriptase. Many PE enzymes and related tools are available: PE2 - introduction of five...