Skip to main content

We narrowed to 840 results for: Met;

Showing: 801 - 820 of 840 results
  1. Fluorescence Titering Assay

    Type
    Protocol
    ...the dilution factors (method 1) or the volume of virus (method 2): Method 1 Method 2 $$T = {N*F*D\over ...with less than 40% fluorescent cells. Titering methods assume one integration event per cell. When the...
  2. Chemogenetics Guide

    Type
    Guide
    .... However, CNO is back-metabolized to clozapine and other clozapine metabolites and these can have off-target...concentrations of clozapine N ‐oxide (CNO). CNO is a metabolite of the antipsychotic clozapine and seems to be...experiments in this species may be entirely due to back-metabolism of CNO to clozapine, demonstrating the need for...activity, and do not seem to have the same back-metabolism issues as CNO and are attractive alternatives...2004). The highly efficacious actions of N-desmethylclozapine at muscarinic receptors are unique and not...
  3. Optogenetics Guide

    Type
    Guide
    ...neural populations. Nat Methods, 11 (3), 338–346. https://doi.org/10.1038/nmeth.2836 PMID: 24509633 Lin...of microbial opsins. Nat Methods, 9 (2), 159–172. https://doi.org/10.1038/nmeth.1808 PMID: 22179551 Wietek...for light control of biological systems. Nat Rev Methods Primers, 2 , 55. https://doi.org/10.1038/s43586...2016). Enhancing Channelrhodopsins: An Overview. Methods Mol Biol, 1408 , 141–165. https://doi.org/10.1007...
  4. Western Blot

    Type
    Protocol
    ...of the device. Select the desired method and make sure the parameters are correct. Transfer for 5–6 min... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...Pipette controller Pipette tips and pipettes Spectrophotometer Heat block Mini gel tank chamber Power supply...using a Pierce BCA Assay Kit or other preferred method for protein determination. Prepare a 50:1 Reagent...
  5. Lentivirus ddPCR Titration

    Type
    Protocol
    ...Titer by a Novel Droplet Digital PCR Method. Hum Gene Ther Methods . 2018 Apr;29(2):96-103. doi: 10.1089...Determine the concentration of each sample on a spectrophotometer. Prepare 25 ng/µL stocks of each sample. Samples...reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer...thermocycling. Thermal Cycling Run the following PCR parameters: Cycling Step Temperature (°C) Time (min) Ramp...
  6. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ...is added to clearly distinguish the steps. This method will help enrich the prep with full (genome containing...adeno-associated virus purification using novel methods improves infectious titer and yield." Gene therapy...Wolfgang, and Lamla Thorsten. Human Gene Therapy Methods. August 2015, 26(4): 147-157. doi:10.1089/hgtb.2015.051...
  7. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...the first step toward efficient gene silencing. Methods for target selection are continuously being improved...and Transforming into Bacteria Use your ligation method of choice. For a standard T4 ligation, mix: 2 μL...Recommended Materials Material Vendor and catalog # Hexadimethrine bromide (polybrene)* Sigma-Aldrich: #H9268 ... et. al. Science . 1996 272:263-267. PubMed . Asymmetry in the assembly of the RNAi enzyme complex. . ...mL antibiotic. Pour plates and store at 4°C. Hexadimethrine Bromide (Polybrene) Prepare a 1mg/mL solution...
  8. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...Culture Introduction This protocol describes methodology for plating antibiotic over-agar for the selection...other small flame source) Incubator Reagents 6 cm diameter LB/agar plates without antibiotic High concentration...). It is, however, more expensive. With a 6 cm diameter petri plate containing solidified LB-agar, pipette...
  9. Water Bath Protocol

    Type
    Protocol
    ... or 70% ethanol Distilled water Disinfectant Thermometer Water bath weights and floats Reagents None needed... example, number of drops per liter. Place a thermometer in the water bath. Oftentimes, the water bath...bath will have a spot to secure the thermometer in place. Turn the water bath on and set the appropriate...
  10. Using a Light Microscope Protocol

    Type
    Protocol
    ...your ocular lens. For example, if you observe something using the 10x objective and your ocular lens is...a slide, you can secure it into place using the metal clips on the stage. Turn on the power source and...drawing skills. Regardless of your image capture method, be sure to record the magnification used, any ...
  11. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic tray Gel imaging system...chamber. Remove the gel from the chamber. Use the metal spatula to gently break the gel cast open. Use a...
  12. AAV Production in HEK293 Cells

    Type
    Protocol
    ... pipette 200–1000 µL single channel pipette Hemocytometer or cell counter Ice bucket CO 2 incubator Pipet...Pipet controller Hazardous waste container pH meter Stir plate Magnetic stir bar Sonicator Ear protection...suspension (no clumps). Count cells using a hemocytometer or cell counter. Seed 350 million cells from...
  13. CRISPR Library Amplification

    Type
    Protocol
    ...concentrations of DNA. In our hands fluorescent dye methods tend to report lower values than Nanodrop, although...been designed with Nanodrop as the quantification method. If all Maxipreps appear to contain sufficient ...Maxipreps as yield can dramatically plateau and sometimes fall off entirely if the column or reagents are...
  14. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...restriction digests have become the most widely used method scientists employ to selectively move a specific...Although this is never an ideal cloning strategy, sometimes it cannot be avoided. If you do have to do so,...
  15. Ligation Independent Cloning

    Type
    Protocol
    ...Independent Cloning You may also like... Cloning Methods Empty Backbone Guide Molecular Biology Protocols...time-consuming ligation step of traditional cloning methods. In traditional cloning, base-pairing in the short...
  16. Sequencing Primers

    Type
    Guide
    ...Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC...
  17. Transfection for Recombinant Antibodies

    Type
    Protocol
    ... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...bead bath Vortex Stir bar Magnetic stir plate pH meter Reagents HEK293 cells Recombinant antibody plasmid...
Showing: 801 - 820 of 840 results