Skip to main content

We narrowed to 15 results for: Met;

Showing: 1 - 15 of 15 results
  1. Molecular Biology Reference

    Type
    Guide
    ...UUG, CUU, CUC, CUA, CUG Lysine Lys K AAA, AAG Methionine Met M AUG Phenylalanine Phe F UUU, UUC Proline ...select or sort the cells by visualization or flow cytometry. Primer Binding Site A short, single-stranded ...To learn more about different types of cloning methods, check out our guide on molecular cloning techniques...developed the process termed Sanger sequencing, sometimes referred to as chain-termination sequencing or... making it an efficient and reliable sequencing method. Figure 3: Summary of Sanger sequencing. Created... assemble the whole puzzle. That’s where NGS (sometimes referred to as “second-generation sequencing”)...assemble the entire sequence using bioinformatic methods. It is important to note that NGS platforms in ...
  2. Antibody Guide

    Type
    Guide
    ...Overview Quantification Methods Capture Methods Visualization Methods Cell Sorting Methods Multiplex Assays ...Antibody Applications - Cell Sorting Methods Flow cytometry Flow cytometry, used commonly in immunology, allows... through the indirect detection method. In the direct detection method, the signaling molecule is conjugated...Antibody Applications - Quantification Methods Quantification methods, such as western blots or ELISAs, are...output measured. This method can be performed using the indirect detection method via a conjugated secondary...sample. Controls for quantification methods Quantification methods should be run with: a positive control...included. Antibody Applications - Capture Methods Capture methods such as immunoprecipitation (IP) and chromatin...
  3. Plan Your Experiment

    Type
    Guide
    ...delivery The first of these methods is RNA delivery of Cas and gRNA. This method involves using in vitro ...endosomal approach. Similar to the mRNA method described above, this method is also transient, as the RNPs will... edit using DNA-based methods like sequencing or digital PCR , RNA-based methods like qPCR , and/or protein-based...protein-based methods like a Western blot . Validation Methods There are several common ways to verify...cells. The system may be delivered using viral methods, as DNA or mRNA encoding the Cas enzyme and gRNA...Delivery Using Plasmids The most straightforward method to deliver a CRISPR system into mammalian cells... efficiently transfect. However, note that this method is most useful for cell lines that you can transfect...
  4. CRISPR Guide

    Type
    Guide
    ...toxins, cell viability, and tumor metastasis. One of the most popular methods for conducting genome-wide screens...activation through cytosine demethylation DNMT3A — repression through cytosine methylation MQ1 — repression through... to conventional methods for genomic purification, CRISPR-based purification methods are more straightforward... currently no defined measure of fidelity, so sometimes they will be referred to as increased fidelity...Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes lead to less off-target... editing is a “search and replace” gene editing method in which Moloney Murine Leukemia Virus Reverse ...Although lentiviral libraries are the most popular method for CRISPR screening, they are not suitable for...
  5. Molecular Cloning Techniques

    Type
    Guide
    ...cloning techniques, focusing on seven common cloning methods....replication and protein expression. There are many methods that allow you to move around pieces of DNA. Oftentimes...Check out our blog on choosing the right cloning method for your research project . This guide highlights...highlights several of the most popular cloning methods for the creation of recombinant DNA. Restriction Enzyme...endonuclease) molecular cloning is the "classic" cloning method, and remains one of the most popular today. Restriction...can be time-consuming compared to other cloning methods. Read more in our Restriction Cloning blog post...Gateway cloning is a recombination-based cloning method. During Gateway, moving a piece of DNA from one...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...multiplexable method for genome-wide mapping of lentiviral integration sites. Molecular Therapy — Methods & Clinical...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids...HEK293T cells using your preferred transfection method. The HEK293T cells will produce the viral vectors...screens, lentiviral vectors are a preferred delivery method when conducting cellular barcoding experiments....lentiviral vectors, they have been seen as an effective method for in vivo gene delivery. Lentiviral vectors are...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...viral replication (E4, E2a and VA). These are sometimes combined within the packaging plasmid. For a summary...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids...mutations or insertions in the Cap region. Several methods have been developed and successfully employed to...and a systemic AAV capsid could avoid invasive methods such as intracranial injection. Systemic capsids...Cas9 elements, making it one of the most common methods for in vivo CRISPR-based genome editing. Packaging...
  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids...cells (Figure 3A), similar to lentiviral packaging methods . The three plasmids described above (envelope,...these genes on separate plasmids ( in trans ). This method, therefore, reduces the number of plasmids that...pseudotyping. Figure 3: Gamma-retroviral vector packaging methods. Viral Vector Integration Much like lentiviral ...protocol is for lentiviral vectors, but a similar method can be applied when using gamma-retroviral vectors...
  9. Adenovirus Guide

    Type
    Guide
    ...most popular choice due to their well-established methods, relative simplicity of production, and higher ...from the HV in final viral preparations. Several methods to avoid HV contamination have been developed, ...plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly,...or may only be compatible with certain cloning methods (such as a Gateway destination vector), so be sure...your chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids... by Bert Vogelstein’s lab , is the most popular method for creating first-generation rAdV vectors, which...supercoiled pAdEasy and the shuttle plasmid, but this method results in a higher background of non-recombinant...
  10. Modular Cloning Guide

    Type
    Guide
    ...functional plasmids. It is a powerful and very efficient method for creating many plasmids from different combinations...common set of components (Weber et al., 2011). This method, based on Golden Gate plasmid assembly, exploits...building synthetic genetic circuits, engineering metabolic pathways, assembling gene-editing tools, and more...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ...ubiquitination cascades of different organisms in E. coli . MetClo DNA Assembly Kit Bacterial Expression Christopher... for assembling large DNA fragments based on methylation-switching. 4G-Cloning Plasmid Kit Bacterial Expression...cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can be used with...
  11. Optogenetics Guide

    Type
    Guide
    ...neural populations. Nat Methods, 11 (3), 338–346. https://doi.org/10.1038/nmeth.2836 PMID: 24509633 Lin...of microbial opsins. Nat Methods, 9 (2), 159–172. https://doi.org/10.1038/nmeth.1808 PMID: 22179551 Piatkevich...Optogenetics Experiment Before starting, check the Methods section of the original report or recent publications...for light control of biological systems. Nat Rev Methods Primers, 2 , 55. https://doi.org/10.1038/s43586...2016). Enhancing Channelrhodopsins: An Overview. Methods Mol Biol, 1408 , 141–165. https://doi.org/10.1007...
  12. Chemogenetics Guide

    Type
    Guide
    .... However, CNO is back-metabolized to clozapine and other clozapine metabolites and these can have off-target...concentrations of clozapine N ‐oxide (CNO). CNO is a metabolite of the antipsychotic clozapine and seems to be...experiments in this species may be entirely due to back-metabolism of CNO to clozapine, demonstrating the need for...activity, and do not seem to have the same back-metabolism issues as CNO and are attractive alternatives...2004). The highly efficacious actions of N-desmethylclozapine at muscarinic receptors are unique and not...
  13. Sequencing Primers

    Type
    Guide
    ...Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...virus Reverse MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC...
  14. Guide to Using Pooled Libraries

    Type
    Guide
    ...studies. Advantages Broad range of perturbation methods Can target systems incompatible with CRISPR Can...screens. Both types of screen employ a selection method relevant to the phenotype being studied. An example...
  15. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 1 - 15 of 15 results