We narrowed to 850 results for: met
-
TypeProtocol...your ocular lens. For example, if you observe something using the 10x objective and your ocular lens is...a slide, you can secure it into place using the metal clips on the stage. Turn on the power source and...drawing skills. Regardless of your image capture method, be sure to record the magnification used, any ...
-
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic tray Gel imaging system...chamber. Remove the gel from the chamber. Use the metal spatula to gently break the gel cast open. Use a... -
Optogenetics Guide
TypeGuide...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User... comparative analysis of microbial opsins. Nat Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson...2016. Enhancing Channelrhodopsins: An Overview. Methods Mol Biol. 1408:141-65. PMID 26965121 Yizhar O, ... -
AAV Production in HEK293 Cells
TypeProtocol... pipette 200–1000 µL single channel pipette Hemocytometer or cell counter Ice bucket CO 2 incubator Pipet...Pipet controller Hazardous waste container pH meter Stir plate Magnetic stir bar Sonicator Ear protection...suspension (no clumps). Count cells using a hemocytometer or cell counter. Seed 350 million cells from... -
CRISPR Library Amplification
TypeProtocol...concentrations of DNA. In our hands fluorescent dye methods tend to report lower values than Nanodrop, although...been designed with Nanodrop as the quantification method. If all Maxipreps appear to contain sufficient ...Maxipreps as yield can dramatically plateau and sometimes fall off entirely if the column or reagents are... -
Protocol - How to Perform a Diagnostic Digest
TypeProtocol...restriction digests have become the most widely used method scientists employ to selectively move a specific...Although this is never an ideal cloning strategy, sometimes it cannot be avoided. If you do have to do so,... -
Ligation Independent Cloning
TypeProtocol...Independent Cloning You may also like... Cloning Methods Empty Backbone Guide Molecular Biology Protocols...time-consuming ligation step of traditional cloning methods. In traditional cloning, base-pairing in the short... -
Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps
TypeProtocol...Quantification Measure DNA concentration with a spectrophotometer Restriction Digests Cut and analyze plasmid...cells Antibody Validation Using the Indirect ELISA Method Run an indirect ELISA against a purified antigen... -
Sequencing Primers
TypeGuide...CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F ATCAGTTCGCTTCTCGCTTC...reverse primer MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC... -
Transfection for Recombinant Antibodies
TypeProtocol... we list the specific equipment, reagents, and methods that we use in our lab at Addgene. Equipment and...bead bath Vortex Stir bar Magnetic stir plate pH meter Reagents HEK293 cells Recombinant antibody plasmid... -
Plasmid Cloning by Restriction Enzyme Digest (with Protocols)
TypeProtocol...from the gel via your favorite gel purification method, it is important to determine the concentration...calculate this based on DNA concentration alone. One method is to conduct 2 ligations for each plasmid you ... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...two 75 cm 2 flasks, etc. Pro-Tip This selection method results in a polyclonal cell population, meaning...screening. Sanjana NE, Shalem O, Zhang F. Nature Methods. 2014 Aug;11(8):783-4 (Link opens in a new window... -
AAV ddPCR Titration
TypeProtocol...reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer...thermocycling. Thermal Cycling Run the following PCR parameters. Cycling Step Temperature (°C) Time (min) Ramp... -
Kit Free RNA Extraction
TypeProtocol...the quality of your RNA sample(s) using a spectrophotometer (such as a Nanodrop), agarose gel, or bioanalyzer... -
Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs
TypeProtocol... protect your feet. Pro-Tip If they are able, sometimes scientists work for a long time while standing... -
Protocol - How to Streak a Plate
TypeProtocol...often true for large unstable plasmids, which sometimes recombine at 37 °C. Be sure to check this before... -
Guide to Using Pooled Libraries
TypeGuide...screens. Both types of screen employ a selection method relevant to the phenotype being studied. Examples... -
Protocol - How to Perform Sequence Analysis
TypeProtocol...manually call the correct base at the position. Sometimes an “N” is the result of an erroneous insertion... -
Promoters
TypeGuide...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol... some biohazardous waste, an autoclave or other method for decontaminating must be used for proper disposal...