We narrowed to 1,076 results for: TOR
-
TypeCollection...colleagues. Please acknowledge the Principal Investigator, cite the article in which they were created...
-
Adenovirus Guide
TypeGuide...Guides Adenoviral Vector Guide Adenoviral Vector Guide Jump To: Adenoviral Vectors Vector Production Integration...Read our adenoviral vector guide to learn about adenoviral vector components, production and common uses...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...adenoviral (rAdV) vectors in order to deliver genetic cargo into cells. Most rAdV vectors are based on adenovirus...Generations First-generation rAdV vectors The first generation of rAdV vectors was developed by removing the...-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors Second-generation...Second-generation rAdV vectors contain the genomic deletions of first-generation rAdV vectors, as well as the deletion... -
Adeno-associated virus (AAV) Guide
TypeGuide...Guides AAV Vector Guide Adeno-Associated Viral (AAV) Vector Guide Jump To: AAV Vectors Vector Production...vitro factories for the new viral particles in the laboratory. The cell line used for rAAV vector production...Read our adeno-associated viral vector guide to learn about AAV vector components, production and common...used as viral vectors for gene therapy applications. This guide contains many viral vector-specific terms...adenovirus, read our Adenoviral Vector Guide . Recombinant AAV Vectors Wild-type AAVs have been modified...Plasmids required for rAAV vector production. Created with BioRender.com. AAV Vector Production Cloning Cloning...protocols, see Addgene’s Viral Vector Protocols . Figure 3: Overview of rAAV vector production. Created with... -
Chemogenetics Guide
TypeGuide...Chemogenetic Receptors: RASSLs The first chemogenetic receptors were based on G-protein coupled receptors, or ...Modification of the beta 2-adrenergic receptor to engineer a receptor-effector complex for gene therapy. J Biol...References Chemogenetic tools are actuators for specific cellular pathways, receptors, or ion channels targeted...Specifically, Receptors Activated Solely by Synthetic Ligands (RASSLs) based on κ-opiod receptors (Coward et...intracellular calcium stores. There are currently three Gq DREADDs based on human muscarinic receptors: hM1Dq, hM3Dq...muscarinic receptors, hM2Di and hM4Di, and a Gi DREADD based on the human κ-opoid receptor, termed KORD...turkey erythrocyte β-adrenergic receptor with a rat M3 muscarinic receptor. This DREADD was shown to have... -
CRISPR Guide
TypeGuide...classes of base editors were cytosine base editors (purine-to-purine) and adenine base editors (pyrimidine-to-pyrimidine...base editors that can catalyze base transversions. These editors are based on cytosine base editors and...finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists ...base editors, the evolved TadA domain is fused to Cas9n or dCas9 to create the adenine base editor. The...systems use a type V-K Cas effector, Cas12k. No matter the system, the Cas effectors lack nuclease activity...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins in... -
Sequencing Primers
TypeGuide...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC...promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... -
Promoters
TypeGuide...for RNA polymerase and transcription factors. Transcription factors are proteins which recruit RNA polymerase...by various DNA regulatory sequences including enhancers, boundary elements, insulators, and silencers....also contains transcription factor binding sites, but mostly contains regulatory elements. Eukaryotic Promoters...sigma factors which assist the RNA polymerase in binding to the promoter region. Each sigma factor recognizes...the RNA polymerase, an operator, a segment of DNA in which a repressor or activator can bind, and the structural... Promoters are a vital component of expression vectors because they control the binding of RNA polymerase...core RNA polymerase requires an associated sigma factor for promoter recognition and binding. On the other... -
Optogenetics Guide
TypeGuide...signals; e.g., calcium indicators In this overview, we will focus on the common actuators used in optogenetics...Depending on your answer, you’d pick an excitatory or inhibitory opsin, respectively. Color of activation...site of the viral vector, rather than in all cells. For example, using a viral vector with a floxed opsin...classified based on their functions into two groups: Actuators are genetically-encoded tools for light-activated...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ...VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos Inhibitory (Hyperpolarizing) ChR Variants. Alternatively...SwiChRca Chloride-conducting channel, Step-waveform inhibitory ChR with mutation C128A (derived from C1C2 chimera... -
Antibody Guide
TypeGuide...antibodies can be stored at 4 °C for short-term storage. For long-term storage they should be stored at -20 °C... Antibody Handling Storage Check the manufacturer’s instructions for exact storage requirements. As a ...tips for storing your antibody: Antibodies conjugated to fluorophores should never be stored below 4 °... antibodies should not be stored in sodium azide, as it acts as an inhibitor to HRP. In those cases, thimerosal...define key terms, summarize antibody production and storage techniques, and explain common applications. Science...expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell, and sample... a primary antibody, which becomes the limiting factor for the number of proteins you can detect in a ... -
Plan Your Experiment
TypeGuide... in a single lentiviral transfer vector or separate transfer vectors May contain reporter gene (e.g. GFP...or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual) gRNA targeting the region where...reduced efficiency compared to NHEJ knockout. Base editors can make a limited set of mutations. Repress or...without permanently modifying the genome dCas9-activator (such as dCas9-VP64) gRNA(s) targeting promoter...promoter elements of target gene Many different activators exist, including the multi-plasmid SAM system. Select...Components of System Application Mammalian expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha...lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression of Cas9 and/or... -
Molecular Biology Reference
TypeGuide...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...study). Expression vectors must contain a promoter sequence, a transcription terminator sequence, and the...DLYDDDDK Thrombin LVPRGS BAD (Biotin Acceptor Domain) GLNDIFEAQKIEWHE Factor Xa IEGR or IDGR VSVG YTDIEMNRLGK...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...can be replicated easily and efficiently in a laboratory setting. Stable - Plasmids are stable long-term...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a... -
Addgene's eBook Collection
TypeGuide...viral vectors contains an introduction to each vector and its applications, tips for using vectors in your...Overlay Select Viral Vectors 101 July 2024 | Second Edition About Viral Vectors 101 July 2024 | ...protein; information on FRET, biosensors, and monitoring protein localization; an introduction to non-...the many career options in science, advice on mentoring and management, resources for identifying your... -
Cloning
TypeGuide...shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase enzymes...a simple and efficient cloning method, gateway vectors and recombination enzymes can be quite expensive...comes from a pre-cut, linear, cloning ready TOPO® vectors that has a DNA topoisomerase I fused to the 3’ ...ready, and it is not feasible to create a TOPO® vector yourself. Additionally, the efficiency can vary...overhangs of 10-12 base pairs on the 5' end of both the vector and insert. These overhangs can easily anneal creating...primers for the insert, based on the destination vector sequence and choice of restriction site. Because... -
Educational Resources
TypeGuide... a wide range of topics in molecular biology, laboratory research, and career development. eBooks Download... Titles include: Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide... How-to Blog Read about plasmids in Addgene’s repository , and related molecular biology techniques. Topics... Engineering Fluorescent Proteins CRISPR Viral Vectors Plasmid Technology Career Readiness Molecular Biology... Biology Learn about plasmids, sequencing, vectors, and restriction enzymes to assist with your molecular... -
Science Guides
TypeGuide...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the... -
Guide to Using Pooled Libraries
TypeGuide...only a subset of genes, or very large (e.g. the Toronto KnockOut (TKO) library from the Moffat lab has ... to amplify the library, please refer to the depositor’s protocol for the best results. For some libraries...genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out our blog posts featuring ...