We narrowed to 268 results for: aav
-
TypeCollection...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a retroviral...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in...
-
Our New Antibody Mascot is....
TypeBlog Post... Last month, we introduced you to Blugene and Aavery's newest friend, our Addgene antibody mascot, here...on Feb. 24. Stay tuned! Original Blugene and Aavery would like your attention, please, as they introduce...AntibodyMakesThree on Twitter. As with Blugene and Aavery, we’re looking for a gender neutral name (and it... -
General Transfection
TypeProtocol...of HEK293T cells optimized for viral production (AAVpro or Lenti-X), but any HEK293T cell line should work... -
Typing CRISPR Systems
TypeBlog Post...362(6416), 839–842. https://doi.org/10.1126/science.aav4294 Hu, C., Myers, M. T., Zhou, X., Hou, Z., Lozen... 363(6422), 88–91. https://doi.org/10.1126/science.aav7271 Yoshimi, K., & Mashimo, T. (2022b). Genome ... -
Let There Be LITE Plasmids
TypeBlog Post...offers a tip: save yourself some time by making an AAV1 supernatant. (The details can be found here.) So... -
What's New in CRISPR - March 2020
TypeBlog Post...design and delivery. They generated hPSC lines with AAVS1-integrated, inducible, and fluorescent dCas9-KRAB... -
CRISPR 101: Cas9 Nickase Design and Homology Directed Repair
TypeBlog Post...situation thought to be suboptimal for HDR. At the AAVS1 locus, the two nearest gRNAs had cleavage sites ... -
Hot Plasmids - October 2022
TypeBlog Post...available as Cre-dependent, EF1ɑ-driven viral vectors (AAV1) - and you can also find several other constructs... -
Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2
TypeBlog Post...editing at three different genomic sites in the AAVS1 locus using GEmCherry2. In this experiment they ... -
Plasmids 101: The protein expression toolbox
TypeBlog Post...action Check out Addgene's Lentiviral Tet-on and AAVS1 targeted Tet-on transgene vector. Degron tags Tagging... -
PITChing MMEJ as an Alternative Route for Gene Editing
TypeBlog Post...advantageous to adapt PITCh to insert genes into AAVS1, the “safe harbor locus” of the human genome, as... -
Bioinformatics at Addgene
TypeBlog Post...SeqwellHow to Keep a Lab Notebook for Bioinformatics AnalysesAAV Vector Quality Control: Going the Extra Mile ... -
Neurodegeneration Plasmid Collection
TypeCollection...-FP Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 ...74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637 ...Parkinson's Hilal Lashuel 36055 pAAV asyn WT SNCA CMV Parkinson's Hilal Lashuel 36056 pAAV asyn S87A SNCA CMV Parkinson's...Hilal Lashuel 36066 pAAV asyn S129A SNCA CMV Parkinson's Patrick Aebischer 36067 pAAV asyn S129G SNCA CMV...Hilal Lashuel 36068 pAAV asyn S129E SNCA CMV Parkinson's Hilal Lashuel 36069 pAAV asyn S129D SNCA CMV ...Aebischer 36070 pAAV asyn S87A/S129A SNCA CMV Parkinson's Patrick Aebischer 36071 pAAV asyn S87D/S129A...Lashuel 107543 pAAV-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Hélène Marie 107544 pAAV-AICD-NES-IRES-hrGFP... -
Validated gRNA Sequences
TypeCollection...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes... -
CRISPR Plasmids - Tagging
TypeCollection...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...Addgene 41815 or #44719 ) in combination with gRNA_AAVS1-T2 (Addgene #41818) or using an all in one vector...vector from the Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which expresses an untagged...safe harbor" locus: eSpCas9(1.1)_No_FLAG_AAVS1_T2 Doyon Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...the genome. In this work, they use AAVS1_Puro_PGK1_3xFLAG_Twin_Strep and nuclease driven recombination ... -
Immunology Research Plasmids and Resources
TypeCollection...processes. Addgene Blogs Adeno Associated Virus (AAV) for Cell and Gene Therapy Cancer and the Immune ...