Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 319 results for: virus

Showing: 251 - 300 of 319 results

  1. Luciferase Plasmid Collection

    Type
    Collection
    ...luciferase; GFP is expressed if cells are infected with virus Christopher Buck 98580 pLX304 Luciferase-V5 blast...

  2. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV) Cow ( B. taurus ) Library Size Genome-wide...cells). Most CRISPR libraries require the use of lentivirus to deliver the gRNA/Cas9 to target cells. Therefore...Therefore, you must be equipped and authorized to use lentivirus in your lab. Once you have determined that CRISPR-based...

  4. Zhang Lab CRISPR Page

    Type
    Collection
    ... of Cas9 and sgRNA in vivo via adeno-associated virus (AAV). The single vector system uses a smaller Cas9...Addgene plasmids #61425 - #61427 are intended for lentivirus production : 61425 : lentiviral vector encoding...codon-optimized SaCas9 driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine...

  6. Immunology Research Plasmids and Resources

    Type
    Collection
    ...responses of the immune system upon infection with virus and, like other cytokines, enable communication ...TCF16 CR2 complement component (3d/Epstein Barr virus) receptor 2 C3DR, CD21, SLEB9 FCGR2B Fc fragment... 1 (Xenopus laevis) DKK-1, SK EBI3 Epstein-Barr virus induced 3 IL27B EDN1 endothelin 1 ET1, HDLCQ7 EDN2...fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog) HBGF...receptor GPR38, MTLR1 MPL myeloproliferative leukemia virus oncogene C-MPL, CD110, MPLV, TPOR MSTN myostatin...described. Symbol Name Synonyms EBI3 Epstein-Barr Virus Induced 3 IL35B, IL27B, IL35 subunit IL10RA interleukin...

  7. Biosensor AAV Preps

    Type
    Collection
    ...vector packaging service, but lets us know what viruses would be helpful to the scientific community. Return...

  8. CRISPR Guide

    Type
    Collection
    ... be efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9...editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused to the...H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace" ...need to generate lentivirus containing the entire library (Figure 8D). This lentivirus will then be used...delivery to cells that are poorly transduced by lentivirus. Non-mammalian CRISPR libraries are also available...as liquid DNA, or in select cases, as pre-made lentivirus . DNA libraries are shipped at a concentration...need to either co-infect with a Cas9-producing lentivirus or use a Cas9-expressing stable cell line. After...

  10. Cre-lox system

    Type
    Collection
    ...11919 pBS448 RSV-GFPcre Cre-GFP fusion Rous sarcoma virus (RSV) LTR/promoter Mammalian Sauer 11920 pBS500 ...

  11. Genome-wide Screening Using CRISPR

    Type
    Blog Post
    ...generate lentivirus (B). Cas9-expressing cells or wild-type cells are treated with lentivirus containing... Quick Guide to All Things Lentivirus Get Tips on Titering Your Lentivirus Plasmids 101: NGS Quality Control...genome wide-screening experiments commonly use lentivirus to deliver a pooled population of gRNAs to Cas9... concentration that is sufficient to generate lentivirus. Be sure to use next-generation sequencing to...the steps above! Cells are then transduced with lentivirus containing the CRISPR library to generate a heterogeneous...

  12. CRISPR Antimicrobials

    Type
    Blog Post
    ... But what if we could specifically target only virulent or antibiotic resistant bacteria with a weapon...no antibiotic strategy available to target only virulent or antibiotic resistant bacteria, and inappropriate...antimicrobials can target specific sequences in a single virulent bacterial species, or even an antibiotic resistance...Bikard et al. used a phagemid system to target virulent S. aureus, a common hospital-borne infection. ...phagemid treatment were sufficient to wipe out the virulent strain. Bacteria not killed by the first round...phagemid treatment decreased the proportion of virulent S. aureus from 50% to 11% in just 24 hours.   ...they suggest that targeting multiple resistance/virulence factors may further reduce this likelihood. The...

  13. Making CRISPR Plasmids Using Fragmid

    Type
    Blog Post
    ...Mammalian Lentivirus pRDA_512 (RSV-driven; lentiGuide-based) Mammalian Lentivirus pRDA_722...lentiCRISPRv2-based; preferred over 512) Mammalian Lentivirus pRDA_789 (CMV-driven; CROPseq) Mammalian...Organism (Mammalian or drosophila) Delivery type (lentivirus, AAV, transposon, Plasmid) Destination vector...

  20. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...Jaenisch’s lab in plasmid form or as ready-to-use lentivirus. Figure 2: dCas9-Tet1 demethylates cytosines...with the former also available as ready-to-use lentivirus. Figure 3: dCas9-DNMT3A methylates cytosines...

  21. Plasmids for Stem Cell Research

    Type
    Collection
    ...Delivery Method Species Description Article PI Lentivirus Human Expression of human Oct4, Sox2, Klf4, Myc.... Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, ...Science. 2007 Dec 21;318(5858):1917-20. Thomson Lentivirus Human Doxycycline-inducible expression of human...Stem Cell. 2008 Sep 11. 3(3):346-53. Jaenisch Lentivirus Human Single polycistronic lentiviral vector .... Stem Cells. 2009 May . 27(5):1042-9. Townes Lentivirus Human Single polycistronic lentiviral vector ...Stem Cells Dev. 2010 Aug;19(8):1221-9. Cibelli Lentivirus Human Single polycistronic, doxycycline-inducible...Pluripotency. Cell. 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of human Klf4, Oct4, c-Myc, ...

  22. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...science.aaa3380 MuLE vectors for customized lentivirus production Finding a lentiviral vector backbone...the process of creating complex polycistronic lentiviruses. The MuLE toolbox contains a series of building-block...tRNA/aaRS pairs are delivered via a pseudotyped baculovirus system, which is advantageous compared to other...

  23. Ginkgo Bioworks COVID-19 Collection

    Type
    Collection
    ...or sort buttons to find SARS-CoV-2 and common coronvirus plasmids based on: Gene insert (e.g. spike, envelope...Codon-optimized expression (recode) Truncated for making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags...collection at Addgene. Addgene's COVID-19 and Coronavirus Plasmids & Resources page outlines our entire...

  24. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...deficient and depend on other viruses such as adenovirus or herpes simplex virus to replicate in the host ...Elements Glossary Adeno-Associated Viruses (AAV) are small, non-enveloped viruses containing a small, linear ...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...Tropism Adeno Associated Virus (AAV) for Cell and Gene Therapy Adeno-associated Viruses (AAVs) for Genome Editing...Definition Adeno-associated virus (AAV) Wildtype, small, nonenveloped viruses from the Parvoviridae family...replication process where the virus uses the cell machinery to produce new viruses, eventually lysing the cell...available at Addgene. Adeno-Associated Virus versus Adenovirus Adenoviruses (AdV) are part of the Adenoviridae...

  25. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...leukemia virus (MLV), murine sarcoma virus (MSV), and feline leukemia virus (FeLV). Retroviruses are partially...Gibbon Ape Leukemia Virus (GALV) — T and B cell transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein... that a virus can infect and replicate in. Viral vector The modified form of a wild-type virus used to...packaging genes, while lentiviruses also contain accessory genes specific to each virus type. From an experimental...pathogen, like viruses or bacteria, within a host organism, leading to disease. Provirus The genetic material...packaging genes. However, they are different viruses and require different isoforms of these packaging components...to wide infectivity VSV-G (vesicular stomatitis virus G protein) is the most common envelope gene, due...

  26. Adenovirus Guide

    Type
    Guide
    ...genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses that belong to the Parvoviridae...infectious diseases such as COVID-19, Ebola virus, and Zika virus. Chimpanzee adenoviral (ChAdV) vectors have...2021). Adenovirus biology, recombinant adenovirus, and adenovirus usage in gene therapy . Viruses, 13 (...plasmids available at Addgene. Adenovirus versus Adeno-Associated Virus Adenoviruses fall under the Adenoviridae...Plasmid Elements Glossary Adenoviruses (AdV) are medium-sized, non-enveloped viruses containing a linear double-stranded.... Characterization of a Species E Adenovirus Vector as a Zika virus vaccine . Scientific Reports, 10 (...Matsunaga, W., & Gotoh, A. (2023). Adenovirus as a vector and oncolytic virus . Current Issues in Molecular...

  27. 2021 Deck the Lab Winners!

    Type
    Blog Post
    ...them out: https://t.co/uDEE9PsspD#deckthelab #virussnowflakes #sciart #thankyouscience #scicomm pic.twitter.com...

  30. Lentiviral Vector Guide

    Type
    Guide
    ...types of lentivirus include Human immunodeficiency virus (HIV), bovine immunodeficiency virus (BIV), and... that a virus can infect and replicate in. Viral vector The modified form of a wild-type virus used to..., like viruses or bacteria, within a host organism, leading to disease. Lentivirus A retrovirus from the... and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability to...and accessory genes specific to each virus type, while retroviruses only contain packaging genes. From ...different viruses and require different isoforms of these packaging components. Therefore, lentivirus may not...Wild-type lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific...

  35. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse primer...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg...-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...Forward GCTCGATACAATAAACGCC (Invitrogen) Rous sarcoma virus (RSV) promoter, forward primer pRS-marker CGGCATCAGAGCAGATTGTA...primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of Rous sarcoma virus (RSV) env gene, forward primer Rluc-F CCAGGATTCTTTTCCAATGC...

  43. Plasmids 101: Cre-lox

    Type
    Blog Post
    ...been constructed. Additionally, Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to...

  46. Lab to Office Culture Shock

    Type
    Blog Post
    ...focusing on my technical skills with cloning and lentivirus production, I didn’t really start to recognize...

  49. Hot Plasmids - November 2023

    Type
    Blog Post
    ... to target multiple delivery systems, such as lentivirus and MMLV gag, to specific cell types. It can ...
Showing: 251 - 300 of 319 results