...TALENs that have been engineered by the Joung, Peterson, and Yeh labs at MGH to target sites within various...

...oligos for cloning but PX330 only uses 20nt? The reason for the 30nt region on the upper is because the...

...Anti-Copper ATPase 2 (Wilson's disease protein) [L62/29] Copper ATPase 2 (Wilson's disease protein) Human...

...Amrani N, Chen JS, Cofsky JC, Kranzusch PJ, Sontheimer EJ, Davidson AR, Maxwell KL, Doudna JA. Cell . Sep 7...Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. Cell . 167(7):1829-1838. PMID...generally low (<10% of modified alleles). For this reason, many laboratories try to enhance HDR by synchronizing...Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T.. Nat Methods . Nov;15(11):928-931. PMID: 30377374... Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier JM, Anegon I, Lopez...genetic screens with multiple modalities. 2018. Sanson KR, Hanna RE, Hegde M, Donovan KF, Strand C, Sullender...Li M, Zhou F, Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu...

...back by the 5' exonuclease. Gibson Assembly (Image from Plasmid 101: Gibson Assembly ) Back to Top Type...Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning Oligo Stitching...cost, availability of starting materials or just personal preference. Check out our blog on choosing the... is the "classic" cloning method, and for many reasons, remains one of the most popular today. Restriction...Plasmid 101 blog post on TOPO cloning. Back to Top Gibson Assembly (Isothermal Assembly Reaction) Isothermal...Isothermal cloning, more commonly known as Gibson assembly ( protocol ), takes advantage of the properties ...lastly DNA ligase fuses DNA strands together. In Gibson assembly DNA fragments with 20-40 base pair homology...

...t/t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos...helveticum 500 Chrimson, ChrimsonR Red-light drivable channel from Chlamydomonas noctigama . ChrimsonR carries...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...Ramakrishnan C, Mattis J, Prakash R, Diester I, Goshen I, Thompson KR, Deisseroth K. 2010 Molecular and cellular ...Klapoetke NC, Murata Y, Kim SS, Pulver SR, Birdsey-Benson A, Cho YK, Morimoto TK, Chuong AS, Carpenter EJ...Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson CA, Sabatini BL 2012. Novel recombinant adeno-associated...21363959 Yizhar O, Fenno LE, Prigge M, Schneider F, Davidson TJ, O'Shea DJ, Sohal VS, Goshen I, Finkelstein...

...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...may need additional processing steps, such as sonication. Denature proteins, using heat and/or chemicals...housekeeping genes). This allows for relative comparison of expression between different samples, by normalizing...normalizing protein expression to the controls before comparison. Alternatively, the samples can be normalized...ChIP protocols use enzyme digestion instead of sonication. This approach is gentler but results in non-...isolated and analyzed. Validation relies on size comparison of peptides. Independent antibody validation ...

...receptors. Neuron 63:27–39. PMID: 19607790 Atasoy D, Sternson SM (2018). Chemogenetic Tools for Causal Cellular...Magnus CJ, Lee PH, Atasoy D, Su HH, Looger LL, and Sternson SM (2011). Chemical and genetic engineering of...Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent chemogenetics for research...therapy. J Biol Chem. 276:1596-6. PMID: 11402033 Sternson SM, Roth BL (2014). Chemogenetic tools to interrogate...J. Biol. Chem. 266:5–8. PMID: 1670767 Vardy E, Robinson JE, Li C, Olsen RHJ, DiBerto JF, et al (2015).... Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, Kotsonis TA, Yuan T, You Z, Wu Z, Xi J, Haberman A, Graham...

...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

...plasmids are based on the HIV-1 virus. For safety reasons, transfer plasmids are all replication incompetent...generation or 3rd generation packaging system. For a comparison of the key differences between the 2nd and 3rd...

...trans-splicing or overlapping vectors: a quantitative comparison. Duan D, Yue Y, Engelhardt JF. Mol Ther. 2001...

...essential tool in molecular biology for a variety of reasons, including that they are: Easy to work with - Plasmids...

...Transposagen What is the piggyBac™ transposon? The piggyBac™ transposon was originally identified in moths...until 2005 [1]. Like other transposons, piggyBac™ has two components, a transposon and a transposase. The ...titrating the transposase to transposon ratios. High ratios of transposase to transposon result in a greater number...ability to distribute plasmids with the piggyBac™ transposon. These plasmids, when combined with a source ...you to quickly transfer a DNA sequence from the transposon vector to one of many TTAA sequences distributed...genome. We encourage you to deposit your piggyBac™ transposon vectors with us to help us expand this useful...transposase facilitates the integration of the transposon specifically at ‘TTAA’ sites randomly dispersed...

...important for social and regulatory reasons. 1.) The transposon consists of a mirrored set of inverted....   The Sleeping Beauty transposon system The Sleeping Beauty (SB) transposon system is one such system...Transposons are sequences of DNA that can move around in a genome. In a laboratory setting, transposons...the site of insertion. In both of these cases, transposons combine the advantages of viruses and naked DNA...mechanisms. The use of non-viral vectors, like transposons, avoids many, though not all, of these defenses...reaction occurs which cuts the DNA.3.) The released transposon can now bind a strand of DNA with a TA dinucleotide...plasmid is empty following the removal of the transposon; the plasmid is then degraded by the cell.4.)...

...but he or she probably has reasons for it. Do not take criticism personally or get defensive. Look at ...important issues in person or over the telephone instead of email. As you cannot see a person’s body language...get nods from nearly every participant. Robert Bramson, author “Coping with Difficult People,” identified...specific strategies to deal with each of these personality types is beyond the scope of this article, there...resolve conflicts What Is Assertiveness? An assertive person is able to communicate their ideas confidently ...your supervisor, even if he or she is a difficult person: 1) Understand your supervisor’s expectations ...or she would like a written report or to meet in person.   Regardless of your supervisor’s management style...

...were usually the products of teams: Watson, Crick, & Franklin, Meselson-Stahl, Hershey-Chase...Who was I ...intelligent, motivated person really could know a little bit about everything or in Jefferson’s case, even a lot...work of more than one person. A selfish part of you might not want another person’s name on your next paper...clear why that person is there. If it becomes clear after a few meetings that a person is neither adding...all our externally facing kit pages. No single person could possibly understand every nuance of how kits...should have a goal, or at the very least, a clear reason for existing. Here are a few types of teams that... - with the possible exception of when Thomas Jefferson dined alone.” There was a time in human history...

...to the conclusion that a conflict is personal (”Person A and Person B just don’t get along”) when in fact...conflict are substantive (“Person C told Person A one thing and inadvertently told Person B something else.")...also be categorized as either “personal” or “substantive”. A personality-based conflict occurs when two...multiple channels is not reasonable or sustainable. That said, when you know that a person or team should be ...large organization, because confirming that every person has read and understood every communication that...assign the responsibility in question to a specific person or team. What Makes You a Good Conflict Resolver... for a fight. But you also can’t be the type of person who avoids conflict at all costs or actively runs...

... result of the necessary restrictions on close personal contacts. However, that should not deter any student... letter can be found on the Addgene blog.   3. Personal statement brilliance In addition to sending in... cover letter, you are always asked to draft a personal statement, which is the perfect opportunity to...questions, thus devoting some time to writing a solid personal statement will pay dividends. This is the only...and forward-looking. Embrace it, and let your personality leap out of the page. Finally, as previously ...find the tools that can help you craft a solid personal statement.  4. Letters of recommendation wisdom...to vouch for the character you painted in your personal statement. Make certain to choose your recommenders...

... year’s Michael Davidson and Roger Tsien Commemorative Travel Awards: Melissa Chiasson, Elizabeth Unger...variation at large scales and making personalized medicine a reality,” Chiasson explains. Elizabeth Unger: Developing...The late Michael Davidson and Roger Tsien played enormous roles in fluorescent protein development by...To honor their legacy, we launched the Michael Davidson and Roger Tsien Commemorative Travel Awards in...Unger, and Michal Bernach. Melissa Chiasson: Quantifying the abundance of thousands of protein variants ...time is time consuming and unscalable.  Melissa Chiasson, a graduate student in Douglas Fowler's lab at...from each bin are then extracted and sequenced. Chiasson is currently using VAMP-seq to study vitamin K...

..., based on resorufin). SNAP-tag: In 2003, Kai Johnsson’s lab developed a self-labeling fusion tag based...Addgene’s collection. CLIP-tag: Also in 2008, Kai Johnsson’s lab reported another AGT-based tag named CLIP-tag...STED) nanoscopy. Scale bar, 2 μm. Inset shows comparison with standard confocal microscopy. Image adapted...159 aa) are smaller than HaloTag (295 aa) – for comparison, common fluorescent proteins are typically 230...Wissner, R. F., Xi, Z., Allgeyer, E. S., Zhong, S., Thompson, A. D., Lowe, N., Butler, R., Bewersdorf, J., ...Strategies Matter for Super-Resolution Microscopy: A Comparison between HaloTags and SNAP-tags. Cell Chemical...Corrêa, I. R., Kindermann, M., Beaufils, F., & Johnsson, K. (2008). An Engineered Protein Tag for Multiprotein...